MirGeneDB

MirGeneDB ID

Isc-Iab-4

Family name IAB-4 (all species)
Seed CGUAUAC
Species Deer tick (Ixodes scapularis)
MiRBase ID isc-mir-iab-4
Paralogues
Orthologues Aae-Iab-4-P1  Aae-Iab-4-P1-as  Aae-Iab-4-P2  Aae-Iab-4-P2-as  Bge-Iab-4  Bge-Iab-4-as  Dan-Iab-4  Dan-Iab-4-as  Dme-Iab-4  Dme-Iab-4-as  Dmo-Iab-4  Dmo-Iab-4-as  Dpu-Iab-4  Dpu-Iab-4-as  Hme-Iab-4  Hme-Iab-4-as  Tca-Iab-4  Tca-Iab-4-as 
Node of Origin (locus) Arthropoda
Node of Origin (family) Arthropoda
Genome context
(IscaWI)
DS891538: 738928-738986 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GCCAGCGUCGUCCUUAGCGGCGCCUCCCGUUCGUAUACUGAGUGUAUCCUGAGUGUUUAAUUUUCCGGUAUACCUUCAGUAUACGUAACGGGGGACCCGGAGAAUGCGCGGAACGGAGA
Get precursor sequence
Structure
        10           20        30         40         50        
GCCAGCGUCGUCCUUAG---   CG  U      -           U    -| U  GUGUU 
                    CGG  CC CCCGUU CGUAUACUGAG GUAU CC GA     \
                    GCC  GG GGGCAA GCAUAUGACUU CAUA GG CU     U
AGAGGCAAGGCGCGUAAGAG   CA  -      U           C    U^ C  UUUAA 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUGUG in loop
Tissue expression
 +
Al Mi Mi Mi Sa Sa Sa Sa To
Mature sequence

Isc-Iab-4_5p (predicted)

MirBase accessionMIMAT0018921
Sequence
0- UCGUAUACUGAGUGUAUCCUGA -22
Get sequence
Star sequence

Isc-Iab-4_3p* (predicted)

MirBase accessionNone
Sequence
35- CGGUAUACCUUCAGUAUACGUAAC -59
Get sequence