MirGeneDB

MirGeneDB ID

Dan-Iab-4-as

Family name IAB-4 (all species)
Seed UACGUAU
Species Fruit fly (Drosophila ananassae)
MiRBase ID
Paralogues Dan-Iab-4 
Orthologues Bge-Iab-4  Bge-Iab-4-as  Dme-Iab-4  Dme-Iab-4-as  Dmo-Iab-4  Dmo-Iab-4-as  Dpu-Iab-4  Dpu-Iab-4-as  Hme-Iab-4  Hme-Iab-4-as  Isc-Iab-4  Tca-Iab-4  Tca-Iab-4-as 
Node of Origin (locus) Pancrustacea
Node of Origin (family) Arthropoda
Genome context
(Dana_caf1)
scaffold_13340: 7215208-7215267 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CACGUCCCGCGUUGAAGGUGUUACCUCGUGUUACGUAUACUGAAGGUAUACCGGAUAGGAUACACUCAGGAUACAUUCAGUAUACGUAUACGAAGUUGCACAAAAUCACCAUCCUCCGUA
Get precursor sequence
Structure
        10          20        30        40        50        60
CACGUCCCGCGUUGAAG--|   U  C      U            G    A  GGAUAGG 
                   GUGU AC UCGUGU ACGUAUACUGAA GUAU CC       A
                   CACG UG AGCAUA UGCAUAUGACUU CAUA GG       U
AUGCCUCCUACCACUAAAA^   U  A      -            A    -  ACUCACA 
.       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Iab-4-as_5p

MirBase accessionNone
Sequence
0- UUACGUAUACUGAAGGUAUACCGG -24
Get sequence
Star sequence

Dan-Iab-4-as_3p*

MirBase accessionNone
Sequence
38- GGAUACAUUCAGUAUACGUAUA -60
Get sequence