MirGeneDB

MirGeneDB ID

Hsa-Mir-430-P9b

Family name MIR-430 (all species)
Seed UCUCCAA
Species Human (Homo sapiens)
MiRBase ID hsa-mir-515-2
Paralogues Hsa-Mir-430-P1  Hsa-Mir-430-P2  Hsa-Mir-430-P3  Hsa-Mir-430-P4  Hsa-Mir-430-P5  Hsa-Mir-430-P6  Hsa-Mir-430-P7  Hsa-Mir-430-P8a  Hsa-Mir-430-P8b  Hsa-Mir-430-P9a  Hsa-Mir-430-P11a  Hsa-Mir-430-P11b  Hsa-Mir-430-P13  Hsa-Mir-430-P14  Hsa-Mir-430-P15a  Hsa-Mir-430-P15b  Hsa-Mir-430-P15c  Hsa-Mir-430-P18  Hsa-Mir-430-P19  Hsa-Mir-430-P20  Hsa-Mir-430-P21  Hsa-Mir-430-P22  Hsa-Mir-430-P23  Hsa-Mir-430-P24  Hsa-Mir-430-P25  Hsa-Mir-430-P26  Hsa-Mir-430-P27  Hsa-Mir-430-P28  Hsa-Mir-430-P29  Hsa-Mir-430-P30  Hsa-Mir-430-P31  Hsa-Mir-430-P32  Hsa-Mir-430-P33  Hsa-Mir-430-P34  Hsa-Mir-430-P35  Hsa-Mir-430-P36  Hsa-Mir-430-P37a  Hsa-Mir-430-P37b  Hsa-Mir-430-P39a  Hsa-Mir-430-P39b  Hsa-Mir-430-P41  Hsa-Mir-430-P42  Hsa-Mir-430-P43  Hsa-Mir-430-P44  Hsa-Mir-430-P45  Hsa-Mir-430-P46  Hsa-Mir-430-P47  Hsa-Mir-430-P48  Hsa-Mir-430-P49  Hsa-Mir-430-P50 
Orthologues Sha-Mir-430-o9 
Node of Origin (locus) H. sapiens
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr19: 53679016-53679074 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P9b)
Mir-430-P8a chr19: 53669177-53669234 [+] UCSC Ensembl
Mir-1323 chr19: 53671978-53672033 [+] UCSC Ensembl
Mir-498 chr19: 53674230-53674289 [+] UCSC Ensembl
Mir-430-P35 chr19: 53675725-53675785 [+] UCSC Ensembl
Mir-430-P9b chr19: 53679016-53679074 [+] UCSC Ensembl
Mir-430-P30 chr19: 53679953-53680011 [+] UCSC Ensembl
Mir-430-P36 chr19: 53682173-53682233 [+] UCSC Ensembl
Mir-430-P9a chr19: 53685022-53685080 [+] UCSC Ensembl
Mir-430-P28 chr19: 53686484-53686543 [+] UCSC Ensembl
Mir-430-P49 chr19: 53688495-53688553 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUUUUGGAGUGAGAAGAUCUCAUGCAGUCAUUCUCCAAAAGAAAGCACUUUCUGUUGUCUGAAAGCAGAGUGCCUUCUUUUGGAGCGUUACUGUUUGAGAAAAACCACGUUGAAGUUGA
Get precursor sequence
Structure
        10          20        30        40        50          
GUUUUGGAGUGAGAAGA--|    U     C  U           A    UU    UUGUC 
                   UCUCA GCAGU AU CUCCAAAAGAA GCAC  UCUG     \
                   AGAGU UGUCA UG GAGGUUUUCUU CGUG  AGAC     U
AGUUGAAGUUGCACCAAAA^    U     U  C           C    --    GAAAG 
       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThis gene was named Mir-430-P10 in MirGeneDB 1.0 but it appears to be part of a human-specific gene duplication and thus is renamed P9b.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-430-P9b_5p

MirBase accessionMIMAT0002826
Sequence
0- UUCUCCAAAAGAAAGCACUUUCUG -24
Get sequence
Validated targets microrna.org: MIMAT0002826
TargetScanVert: hsa-miR-515-5p
TargetMiner: hsa-miR-515-5p
miRDB: MIMAT0002826
Star sequence

Hsa-Mir-430-P9b_3p*

MirBase accessionMIMAT0002827
Sequence
37- GAGUGCCUUCUUUUGGAGCGUU -59
Get sequence
Validated targets microrna.org: MIMAT0002827
TargetScanVert: hsa-miR-515-3p
TargetMiner: hsa-miR-515-3p
miRDB: MIMAT0002827