MirGeneDB

MirGeneDB ID

Hsa-Mir-1323

Family name MIR-1323 (all species)
Seed CAAAACU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-1323
Paralogues
Orthologues Mml-Mir-1323 
Node of Origin (locus) Catarrhini
Node of Origin (family) Catarrhini
Genome context
(hg38)
chr19: 53671978-53672033 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-1323)
Mir-430-P8b chr19: 53666693-53666750 [+] UCSC Ensembl
Mir-430-P8a chr19: 53669177-53669234 [+] UCSC Ensembl
Mir-1323 chr19: 53671978-53672033 [+] UCSC Ensembl
Mir-498 chr19: 53674230-53674289 [+] UCSC Ensembl
Mir-430-P35 chr19: 53675725-53675785 [+] UCSC Ensembl
Mir-430-P9b chr19: 53679016-53679074 [+] UCSC Ensembl
Mir-430-P30 chr19: 53679953-53680011 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAGUCAGACAUGACAUUCAGACUGAGGUCCUCAAAACUGAGGGGCAUUUUCUGUGGUUUGAAAGGAAAGUGCACCCAGUUUUGGGGAUGUCAAUUGUGAAUCCUCAUCAUAACCCA
Get precursor sequence
Structure
        10        20          30        40        50        
AAGUCAGACAUGACAUUCAGAC--|  G             A  G         GUGGU 
                        UGA GUCCUCAAAACUG GG GCAUUUUCU     \
                        ACU UAGGGGUUUUGAC CC CGUGAAAGG     U
ACCCAAUACUACUCCUAAGUGUUA^  G             -  A         AAAGU 
    110       100        90        80         70        60
Deep sequencing
Go to detailed chart
CommentThere are not enough 3p reads to reliably assess whether this is a Group 2 miRNA.
3' NTU Unknown
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-1323_5p

MirBase accessionMIMAT0005795
Sequence
0- UCAAAACUGAGGGGCAUUUUCU -22
Get sequence
Validated targets microrna.org: MIMAT0005795
TargetScanVert: hsa-miR-1323
TargetMiner: hsa-miR-1323
miRDB: MIMAT0005795
Star sequence

Hsa-Mir-1323_3p*

MirBase accessionNone
Sequence
35- AAAGUGCACCCAGUUUUGGGG -56
Get sequence