
MirGeneDB ID


Family name MIR-124 (all species)
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-124-2
Paralogues Ami-Mir-124-P1-v1  Ami-Mir-124-P1-v2  Ami-Mir-124-P2-v1  Ami-Mir-124-P3-v1  Ami-Mir-124-P3-v2  Ami-Mir-124-P4-v1  Ami-Mir-124-P4-v2 
Orthologues Aae-Mir-124  Aca-Mir-124-P2-v1  Aca-Mir-124-P2-v2  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Bta-Mir-124-P2-v1  Bta-Mir-124-P2-v2  Cel-Mir-124  Cfa-Mir-124-P2-v1  Cfa-Mir-124-P2-v2  Cli-Mir-124-P2-v1  Cli-Mir-124-P2-v2  Cpi-Mir-124-P2-v1  Cpi-Mir-124-P2-v2  Cpo-Mir-124-P2-v1  Cpo-Mir-124-P2-v2  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dno-Mir-124-P2-v1  Dno-Mir-124-P2-v2  Dpu-Mir-124  Dre-Mir-124-P2a-v1  Dre-Mir-124-P2a-v2  Dre-Mir-124-P2b-v1  Dre-Mir-124-P2b-v2  Ete-Mir-124-P2-v1  Ete-Mir-124-P2-v2  Gga-Mir-124-P2-v1  Gga-Mir-124-P2-v2  Hme-Mir-124  Hsa-Mir-124-P2-v1  Hsa-Mir-124-P2-v2  Isc-Mir-124  Lan-Mir-124  Mdo-Mir-124-P2-v1  Mdo-Mir-124-P2-v2  Mml-Mir-124-P2-v1  Mml-Mir-124-P2-v2  Mmu-Mir-124-P2-v1  Mmu-Mir-124-P2-v2  Oan-Mir-124-P2-v1  Oan-Mir-124-P2-v2  Ocu-Mir-124-P2-v1  Ocu-Mir-124-P2-v2  Pfl-Mir-124  Pmi-Mir-124  Rno-Mir-124-P2-v1  Rno-Mir-124-P2-v2  Sha-Mir-124-P2-v1  Sha-Mir-124-P2-v2  Sko-Mir-124  Spu-Mir-124  Sto-Mir-124-P2-v1  Sto-Mir-124-P2-v2  Tca-Mir-124  Tgu-Mir-124-P2-v1  Tgu-Mir-124-P2-v2  Xtr-Mir-124-P2-v1  Xtr-Mir-124-P2-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
JH735518: 32852-32909 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-124-P2-v2)
Mir-124-P2-v1 JH735518: 32852-32910 [+] UCSC
Mir-124-P2-v2 JH735518: 32852-32909 [+] UCSC
(pre-Mir +30nt flank)
Get precursor sequence
        10           20        30        40        50         
GCGGUCUUGUUCCCGGG---|   U   C   CC        A   GA        UAAUG 
                    GCUC CGC UCU  GUGUUCAC GCG  CCUUGAUU     \
                    CGAG GCG AGA  CGUAAGUG CGC  GGAAUUAA     U
GACGAGGCGCGGCGGAAGGC^   -   -   AC        G   AC        CAUAC 
      110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
Star sequence


MirBase accessionMIMAT0038125
Get sequence
Mature sequence


MirBase accessionMIMAT0038126
Get sequence