MirGeneDB

MirGeneDB ID

Aca-Mir-133-P4-v2

Family name MIR-133 (all species)
Seed UGGUCCC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues Aca-Mir-133-P1-v1  Aca-Mir-133-P1-v2  Aca-Mir-133-P2-v1  Aca-Mir-133-P2-v2  Aca-Mir-133-P3-v1  Aca-Mir-133-P3-v2  Aca-Mir-133-P4-v1 
Orthologues Aae-Mir-133  Ami-Mir-133-P4-v1  Ami-Mir-133-P4-v2  Asu-Mir-133  Bge-Mir-133  Cbr-Mir-133  Cel-Mir-133  Cin-Mir-133  Cli-Mir-133-P4-v1  Cli-Mir-133-P4-v2  Cpi-Mir-133-P4-v1  Cpi-Mir-133-P4-v2  Cte-Mir-133  Dan-Mir-133  Dme-Mir-133  Dmo-Mir-133  Dpu-Mir-133  Efe-Mir-133  Gga-Mir-133-P4-v1  Gga-Mir-133-P4-v2  Hme-Mir-133  Isc-Mir-133  Lan-Mir-133  Lgi-Mir-133  Oan-Mir-133-P4-v1  Oan-Mir-133-P4-v2  Spu-Mir-133  Sto-Mir-133-P4-v1  Sto-Mir-133-P4-v2  Tca-Mir-133  Tgu-Mir-133-P4-v1  Tgu-Mir-133-P4-v2  Xtr-Mir-133-P4-v1  Xtr-Mir-133-P4-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL343308.1: 91309-91366 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGCGGAUGCCUACGCAUAUGUGUCCCUAGGGCUGGUAAAAAGGAACCAGAUCGACUGGCAACUGGAUUUGGUCCCCUUCAACCAGCUGUGGUGGCACGUGAAAGCAGCCGCUGGAAGC
Get precursor sequence
Structure
        10          20        30        40         50        
AGCGGAUGCCUACGCAU--|      C   G       AAA    A-       CGACUG 
                   AUGUGUC CUA GGCUGGU   AAGG  ACCAGAU      G
                   UGCACGG GGU UCGACCA   UUCC  UGGUUUA      C
CGAAGGUCGCCGACGAAAG^      U   G       AC-    CC       GGUCAA 
      110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-133-P4-v2_5p* (predicted)

MirBase accessionNone
Sequence
0- GCUGGUAAAAAGGAACCAGAU -21
Get sequence
Mature sequence

Aca-Mir-133-P4-v2_3p

MirBase accessionNone
Sequence
37- UUGGUCCCCUUCAACCAGCUG -58
Get sequence