MirGeneDB

MirGeneDB ID

Aca-Mir-1-P4

Family name MIR-1 (all species)
Seed GGAAUGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-1b
Paralogues Aca-Mir-1-P1  Aca-Mir-1-P2  Aca-Mir-1-P3 
Orthologues Aae-Mir-1  Ami-Mir-1-P4  Asu-Mir-1  Bfl-Mir-1  Bge-Mir-1  Cbr-Mir-1  Cel-Mir-1  Cgi-Mir-1  Cin-Mir-1  Cli-Mir-1-P4  Cpi-Mir-1-P4  Cte-Mir-1  Dan-Mir-1  Dme-Mir-1  Dmo-Mir-1  Dpu-Mir-1  Gga-Mir-1-P4  Hme-Mir-1  Isc-Mir-1  Lan-Mir-1  Lgi-Mir-1  Oan-Mir-1-P4  Pfl-Mir-1  Pmi-Mir-1  Sko-Mir-1  Spu-Mir-1  Sto-Mir-1-P4  Tca-Mir-1  Xtr-Mir-1-P4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL343308.1: 91131-91193 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCCCAUUGUCCUGCCUCCCUCUUGAGCCUACAUACUUCUUCAUAUGCCCAUAUGGAGUCGGCCAGAUUUAUGGAAUGUUAAGAAGUAUGUAUCGUUGGGAUGGGAUUGGAACCGUCGACUUC
Get precursor sequence
Structure
        10         20         30        40        50        60 
GCCCCAUUGUCCUGCCU-   -|  UG GCC            C    GC     UGGAGUC 
                  CCC UCU  A   UACAUACUUCUU AUAU  CCAUA       G
                  GGG AGG  U   AUGUAUGAAGAA UGUA  GGUAU       G
CUUCAGCUGCCAAGGUUA   U^  GU GCU            U    A-     UUAGACC 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-1-P4_5p*

MirBase accessionMIMAT0021842
Sequence
0- ACAUACUUCUUCAUAUGCCCAUA -23
Get sequence
Mature sequence

Aca-Mir-1-P4_3p

MirBase accessionMIMAT0021843
Sequence
41- UGGAAUGUUAAGAAGUAUGUAU -63
Get sequence