MirGeneDB

MirGeneDB ID

Aca-Mir-1-P3

Family name MIR-1 (all species)
Seed GGAAUGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-206
Paralogues Aca-Mir-1-P1  Aca-Mir-1-P2  Aca-Mir-1-P4 
Orthologues Aae-Mir-1  Ami-Mir-1-P3  Asu-Mir-1  Bfl-Mir-1  Bge-Mir-1  Bta-Mir-1-P3  Cbr-Mir-1  Cel-Mir-1  Cfa-Mir-1-P3  Cgi-Mir-1  Cin-Mir-1  Cli-Mir-1-P3  Cpi-Mir-1-P3  Cpo-Mir-1-P3  Cte-Mir-1  Dan-Mir-1  Dme-Mir-1  Dmo-Mir-1  Dno-Mir-1-P3  Dpu-Mir-1  Dre-Mir-1-P3a  Dre-Mir-1-P3b  Ete-Mir-1-P3  Gga-Mir-1-P3  Hme-Mir-1  Hsa-Mir-1-P3  Isc-Mir-1  Lan-Mir-1  Lgi-Mir-1  Mdo-Mir-1-P3  Mml-Mir-1-P3  Mmu-Mir-1-P3  Oan-Mir-1-P3  Ocu-Mir-1-P3  Pfl-Mir-1  Pmi-Mir-1  Rno-Mir-1-P3  Sha-Mir-1-P3  Sko-Mir-1  Spu-Mir-1  Tca-Mir-1  Tgu-Mir-1-P3  Xtr-Mir-1-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
1: 122853042-122853101 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGCAAGAGACAAAUUUGUCUUUUUGAGAUUACAUGCUUCUUUAUAUCUCCAUAUGAAUUGCCUUGCUAUGGAAUGUAAGGAAGUGUGUGGUUUCAAGGAGAAGAACCUCCACCUAACAAU
Get precursor sequence
Structure
        10          20        30        40        50          
GGCAAGAGACAAAUUUG--|                            C      UGAAUU 
                   UCUUUUUGAGAUUACAUGCUUCUUUAUAU UCCAUA      \
                   AGAGGAACUUUGGUGUGUGAAGGAAUGUA AGGUAU      G
UAACAAUCCACCUCCAAGA^                            -      CGUUCC 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-1-P3_5p* (predicted)

MirBase accessionMIMAT0021857
Sequence
0- ACAUGCUUCUUUAUAUCUCCAUA -23
Get sequence
Mature sequence

Aca-Mir-1-P3_3p

MirBase accessionMIMAT0021858
Sequence
38- UGGAAUGUAAGGAAGUGUGUGG -60
Get sequence