MirGeneDB

MirGeneDB ID

Mmu-Mir-1-P3

Family name MIR-1 (all species)
Seed GGAAUGU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-206
Paralogues Mmu-Mir-1-P1  Mmu-Mir-1-P2 
Orthologues Aae-Mir-1  Aca-Mir-1-P3  Ami-Mir-1-P3  Asu-Mir-1  Bfl-Mir-1  Bge-Mir-1  Bta-Mir-1-P3  Cbr-Mir-1  Cel-Mir-1  Cfa-Mir-1-P3  Cgi-Mir-1  Cin-Mir-1  Cli-Mir-1-P3  Cpi-Mir-1-P3  Cpo-Mir-1-P3  Cte-Mir-1  Dan-Mir-1  Dme-Mir-1  Dmo-Mir-1  Dno-Mir-1-P3  Dpu-Mir-1  Dre-Mir-1-P3a  Dre-Mir-1-P3b  Ete-Mir-1-P3  Gga-Mir-1-P3  Hme-Mir-1  Hsa-Mir-1-P3  Isc-Mir-1  Lan-Mir-1  Lgi-Mir-1  Mdo-Mir-1-P3  Mml-Mir-1-P3  Oan-Mir-1-P3  Ocu-Mir-1-P3  Pfl-Mir-1  Pmi-Mir-1  Rno-Mir-1-P3  Sha-Mir-1-P3  Sko-Mir-1  Spu-Mir-1  Tca-Mir-1  Tgu-Mir-1-P3  Xtr-Mir-1-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(mm10)
chr1: 20679017-20679076 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-1-P3)
Mir-1-P3 chr1: 20679017-20679076 [+] UCSC Ensembl
Mir-133-P3-v1 chr1: 20682797-20682855 [+] UCSC Ensembl
Mir-133-P3-v2 chr1: 20682797-20682855 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGCCUCGGAGGACACAGCUUCCCCAGGCCACAUGCUUCUUUAUAUCCUCAUAGAUAUCUCAGCACUAUGGAAUGUAAGGAAGUGUGUGGUUUUGGCAAGUGCUUCUUCAAGGCCGAUGG
Get precursor sequence
Structure
        10          20        30        40        50          
GUGCCUCGGAGGACACA--|   C  C                     C U    GAUAUC 
                   GCUU CC AGGCCACAUGCUUCUUUAUAU C CAUA      \
                   UGAA GG UUUGGUGUGUGAAGGAAUGUA G GUAU      U
GGUAGCCGGAACUUCUUCG^   C  U                     A -    CACGAC 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Star sequence

Mmu-Mir-1-P3_5p*

MirBase accessionMIMAT0017004
Sequence
0- ACAUGCUUCUUUAUAUCCUCAUA -23
Get sequence
Validated targets TargetScanVert: mmu-miR-206-5p
miRDB: MIMAT0017004
Mature sequence

Mmu-Mir-1-P3_3p

MirBase accessionMIMAT0000239
Sequence
38- UGGAAUGUAAGGAAGUGUGUGG -60
Get sequence
Validated targets microrna.org: MIMAT0000239
TargetScanVert: mmu-miR-206-3p
miRDB: MIMAT0000239