MirGeneDB

MirGeneDB ID

Ocu-Mir-1-P3

Family name MIR-1 (all species)
Seed GGAAUGU
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID ocu-mir-206
Paralogues Ocu-Mir-1-P1  Ocu-Mir-1-P2 
Orthologues Aae-Mir-1  Aca-Mir-1-P3  Ami-Mir-1-P3  Asu-Mir-1  Bfl-Mir-1  Bge-Mir-1  Bta-Mir-1-P3  Cbr-Mir-1  Cel-Mir-1  Cfa-Mir-1-P3  Cgi-Mir-1  Cin-Mir-1  Cli-Mir-1-P3  Cpi-Mir-1-P3  Cpo-Mir-1-P3  Cte-Mir-1  Dan-Mir-1  Dme-Mir-1  Dmo-Mir-1  Dno-Mir-1-P3  Dpu-Mir-1  Dre-Mir-1-P3a  Dre-Mir-1-P3b  Ete-Mir-1-P3  Gga-Mir-1-P3  Hme-Mir-1  Hsa-Mir-1-P3  Isc-Mir-1  Lan-Mir-1  Lgi-Mir-1  Mdo-Mir-1-P3  Mml-Mir-1-P3  Mmu-Mir-1-P3  Oan-Mir-1-P3  Pfl-Mir-1  Pmi-Mir-1  Rno-Mir-1-P3  Sha-Mir-1-P3  Sko-Mir-1  Spu-Mir-1  Tca-Mir-1  Tgu-Mir-1-P3  Xtr-Mir-1-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(oryCun2)
chr12: 41638561-41638620 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-1-P3)
Mir-1-P3 chr12: 41638561-41638620 [+] UCSC Ensembl
Mir-133-P3-v1 chr12: 41642532-41642590 [+] UCSC Ensembl
Mir-133-P3-v2 chr12: 41642532-41642590 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGCUUCGGAUGACCCUGCUUCCCGAGGCCACAUGCUUCUUUAUAUCCCCAUACGGAUUACUUUGCUAUGGAAUGUAAGGAAGUGUGUGGUUUCGGCAGGCGCCUCUUCGCUGGCCCCAU
Get precursor sequence
Structure
        10          20        30        40        50          
CUGCUUCGGAUGACCCU--|   C                        CC     CGGAUU 
                   GCUU CCGAGGCCACAUGCUUCUUUAUAU  CCAUA      \
                   CGGA GGCUUUGGUGUGUGAAGGAAUGUA  GGUAU      A
UACCCCGGUCGCUUCUCCG^   C                        A-     CGUUUC 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
He Ki Te To Wh
Star sequence

Ocu-Mir-1-P3_5p*

MirBase accessionMIMAT0048327
Sequence
0- ACAUGCUUCUUUAUAUCCCCAUA -23
Get sequence
Mature sequence

Ocu-Mir-1-P3_3p

MirBase accessionMIMAT0048328
Sequence
38- UGGAAUGUAAGGAAGUGUGUGG -60
Get sequence