MirGeneDB

MirGeneDB ID

Lgi-Mir-315

Family name MIR-315 (all species)
Seed UUUGAUU
Species Owl limpet (Lottia gigantea)
MiRBase ID lgi-mir-315
Paralogues
Orthologues Aae-Mir-315  Bge-Mir-315  Cbr-Mir-315  Cel-Mir-315  Cgi-Mir-315-v1  Cgi-Mir-315-v2  Cte-Mir-315  Dan-Mir-315  Dme-Mir-315  Dmo-Mir-315  Dpu-Mir-315  Efe-Mir-315  Isc-Mir-315  Lan-Mir-315  Pfl-Mir-315  Sko-Mir-315  Tca-Mir-315 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Lotgi1)
LOTGIsca_791: 650-711 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CUGAAUAUAAAUUAACAUUAUCUUCUCAAAUUUUGAUUGUUGCUCAGAAAGCCGUAAUGUUUAACUCCGGCGCUCGGGCAACAAUCAACUAAUGAUGGAGGUAUGAAGUCAACAACCAAAUU
Get precursor sequence
Structure
        10         20         30        40        50        60 
CUGAAUAUAAAUUAACAU-       -|  AAUU             A  AA   GUAAUGU 
                   UAUCUUC UCA    UUGAUUGUUGCUC GA  GCC       \
                   AUGGAGG AGU    AACUAACAACGGG CU  CGG       U
UUAAACCAACAACUGAAGU       U^  AAUC             -  CG   CCUCAAU 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Lgi-Mir-315_5p

MirBase accessionMIMAT0009596
Sequence
0- UUUUGAUUGUUGCUCAGAAAGCC -23
Get sequence
Star sequence

Lgi-Mir-315_3p* (predicted)

MirBase accessionNone
Sequence
40- CGCUCGGGCAACAAUCAACUAA -62
Get sequence