MirGeneDB

MirGeneDB ID

Dan-Mir-315

Family name MIR-315 (all species)
Seed UUUGAUU
Species Fruit fly (Drosophila ananassae)
MiRBase ID dan-mir-315
Paralogues
Orthologues Aae-Mir-315  Bge-Mir-315  Cbr-Mir-315  Cel-Mir-315  Cgi-Mir-315-v1  Cgi-Mir-315-v2  Cte-Mir-315  Dme-Mir-315  Dmo-Mir-315  Dpu-Mir-315  Efe-Mir-315  Isc-Mir-315  Lan-Mir-315  Lgi-Mir-315  Pfl-Mir-315  Sko-Mir-315  Tca-Mir-315 
Node of Origin (locus) Bilateria
Node of Origin (family) Bilateria
Genome context
(Dana_caf1)
scaffold_13337: 18585493-18585556 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AUAAGAGCUCCUAAAUGGACACUUAUAUAAUUUUGAUUGUUGCUCAGAAAGCCCUUAUAAAUUAUUAGCUGGCUUUCGAGCAAUAAUUGAAACCAAAUAAGUGAUCCUGACAACAUUUUAAGUG
Get precursor sequence
Structure
        10          20        30        40        50        60  
AUAAGAGCUCCUAAAUGGA--|      AUAA   UG          A       CUUAUAAA 
                     CACUUAU    UUU  AUUGUUGCUC GAAAGCC        \
                     GUGAAUA    AAA  UAAUAACGAG CUUUCGG        U
GUGAAUUUUACAACAGUCCUA^      AACC   GU          -       UCGAUUAU 
  120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Da
Mature sequence

Dan-Mir-315_5p

MirBase accessionMIMAT0008459
Sequence
0- UUUUGAUUGUUGCUCAGAAAGCC -23
Get sequence
Star sequence

Dan-Mir-315_3p*

MirBase accessionNone
Sequence
42- CUUUCGAGCAAUAAUUGAAACC -64
Get sequence