MirGeneDB

MirGeneDB ID

Hsa-Mir-187

Family name MIR-187 (all species)
Seed CGUGUCU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-187
Paralogues
Orthologues Aca-Mir-187  Ami-Mir-187  Bta-Mir-187  Cfa-Mir-187  Cli-Mir-187  Cpi-Mir-187  Cpo-Mir-187  Dno-Mir-187  Dre-Mir-187  Ete-Mir-187  Gga-Mir-187  Mdo-Mir-187  Mml-Mir-187  Mmu-Mir-187  Oan-Mir-187  Ocu-Mir-187  Rno-Mir-187  Sha-Mir-187  Tgu-Mir-187  Xtr-Mir-187 
Node of Origin (locus) Osteichthyes
Node of Origin (family) Osteichthyes
Genome context
(hg38)
chr18: 35904835-35904891 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGCUCACCAUGACACAGUGUGAGACCUCGGGCUACAACACAGGACCCGGGCGCUGCUCUGACCCCUCGUGUCUUGUGUUGCAGCCGGAGGGACGCAGGUCCGCAGCAGAGCCUGCUC
Get precursor sequence
Structure
        10            20        30        40        50       
GGCUCACCAUGACACAG----|   AGA    G    A           C    CGCUGC 
                     UGUG   CCUC GGCU CAACACAGGAC CGGG      U
                     ACGC   GGAG CCGA GUUGUGUUCUG GCUC      C
CUCGUCCGAGACGACGCCUGG^   AG-    G    C           U    CCCAGU 
     110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Star sequence

Hsa-Mir-187_5p*

MirBase accessionMIMAT0004561
Sequence
0- GCUACAACACAGGACCCGGGCG -22
Get sequence
Validated targets microrna.org: MIMAT0004561
TargetScanVert: hsa-miR-187-5p
TargetMiner: hsa-miR-187-5p
miRDB: MIMAT0004561
Mature sequence

Hsa-Mir-187_3p

MirBase accessionMIMAT0000262
Sequence
35- UCGUGUCUUGUGUUGCAGCCGG -57
Get sequence
Validated targets microrna.org: MIMAT0000262
TargetScanVert: hsa-miR-187-3p
TargetMiner: hsa-miR-187-3p
miRDB: MIMAT0000262