MirGeneDB

MirGeneDB ID

Bta-Mir-187

Family name MIR-187 (all species)
Seed CGUGUCU
Species Cow (Bos taurus)
MiRBase ID bta-mir-187
Paralogues
Orthologues Aca-Mir-187  Ami-Mir-187  Cfa-Mir-187  Cli-Mir-187  Cpi-Mir-187  Cpo-Mir-187  Dno-Mir-187  Dre-Mir-187  Ete-Mir-187  Gga-Mir-187  Hsa-Mir-187  Mdo-Mir-187  Mml-Mir-187  Mmu-Mir-187  Oan-Mir-187  Ocu-Mir-187  Rno-Mir-187  Sha-Mir-187  Tgu-Mir-187  Xtr-Mir-187 
Node of Origin (locus) Osteichthyes
Node of Origin (family) Osteichthyes
Genome context
(bosTau8)
chr24: 21530935-21530991 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGCUCCCCACGACACGGUGUGAGACCUCGGGCUACAACACGGGACCCGGGCGCUGCUCCGACCCCUCGUGUCUUGUGUUGCAGCCGGAGGGACGCAAGUCCGCAGCAGAGCCUGCUC
Get precursor sequence
Structure
        10            20        30        40        50       
GGCUCCCCACGACACGG----|   AGA    G    A           C    CGCUGC 
                     UGUG   CCUC GGCU CAACACGGGAC CGGG      U
                     ACGC   GGAG CCGA GUUGUGUUCUG GCUC      C
CUCGUCCGAGACGACGCCUGA^   AG-    G    C           U    CCCAGC 
     110       100         90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-187_5p* (predicted)

MirBase accessionNone
Sequence
0- GCUACAACACGGGACCCGGGC -21
Get sequence
Mature sequence

Bta-Mir-187_3p

MirBase accessionMIMAT0009248
Sequence
35- UCGUGUCUUGUGUUGCAGCCGG -57
Get sequence
Validated targets TargetScanVert: bta-miR-187