MirGeneDB

MirGeneDB ID

Dre-Mir-138-P2

Family name MIR-138 (all species)
Seed GCUGGUG
Species Zebrafish (Danio rerio)
MiRBase ID dre-mir-138-1
Paralogues Dre-Mir-138-P1 
Orthologues Aca-Mir-138-P2  Ami-Mir-138-P2  Bta-Mir-138-P2  Cfa-Mir-138-P2  Cli-Mir-138-P2  Cpi-Mir-138-P2  Cpo-Mir-138-P2  Dno-Mir-138-P2  Ete-Mir-138-P2  Gga-Mir-138-P2  Hsa-Mir-138-P2  Mdo-Mir-138-P2  Mml-Mir-138-P2  Mmu-Mir-138-P2  Oan-Mir-138-P2  Ocu-Mir-138-P2  Rno-Mir-138-P2  Sha-Mir-138-P2  Sto-Mir-138-P2  Tgu-Mir-138-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(danRer11)
chr18: 17580169-17580236 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUGUGAAUAAGAGAGAGGUGUGUGUGCUGCAGCUGGUGUUGUGAAUCAGGCCGAUGUCACACGUCAGCGAUAACCCGGCUAUUUCACAACACCAGGGUGGCACCACACCGCUGCCAACAGUGGAAAUC
Get precursor sequence
Structure
        10           20        30        40        50        60    
GUGUGAAUAAGAGAGAG---|    U    UG AG             UCA     AUGUCACACG 
                    GUGUG GUGC  C  CUGGUGUUGUGAA   GGCCG          U
                    CACAC CACG  G  GACCACAACACUU   UCGGC          C
CUAAAGGUGACAACCGUCGC^    -    GU G-             UA-     CCAAUAGCGA 
      120       110        100         90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Em Ey Gu Gu He Li Li Ov Te
Mature sequence

Dre-Mir-138-P2_5p

MirBase accessionMIMAT0001835
Sequence
0- AGCUGGUGUUGUGAAUCAGGCCG -23
Get sequence
Star sequence

Dre-Mir-138-P2_3p*

MirBase accessionMIMAT0031973
Sequence
47- GCUAUUUCACAACACCAGGGU -68
Get sequence