MirGeneDB

MirGeneDB ID

Dno-Mir-138-P2

Family name MIR-138 (all species)
Seed GCUGGUG
Species Nine-banded armadillo (Dasypus novemcinctus)
MiRBase ID dno-mir-138-2
Paralogues Dno-Mir-138-P1 
Orthologues Aca-Mir-138-P2  Ami-Mir-138-P2  Bta-Mir-138-P2  Cfa-Mir-138-P2  Cli-Mir-138-P2  Cpi-Mir-138-P2  Cpo-Mir-138-P2  Dre-Mir-138-P2  Ete-Mir-138-P2  Gga-Mir-138-P2  Hsa-Mir-138-P2  Mdo-Mir-138-P2  Mml-Mir-138-P2  Mmu-Mir-138-P2  Oan-Mir-138-P2  Ocu-Mir-138-P2  Rno-Mir-138-P2  Sha-Mir-138-P2  Sto-Mir-138-P2  Tgu-Mir-138-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(dasNov3)
JH567044: 128012-128080 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAGCCGCCCGAGUUCUGGUAUCGGUGCUGCAGCUGGUGUUGUGAAUCAGGCCGACGAGCAGCGCAUCCUCUUACCCGGCUAUUUCACGACACCAGGGUUGCAUCAUACCUAUCCUCUCCAGGCGAGCCU
Get precursor sequence
Structure
        10            20        30        40        50        60    
AAGCCGCCCGAGUUCUG----|   C     U  AG             UCA     ACGAGCAGCG 
                     GUAU GGUGC GC  CUGGUGUUGUGAA   GGCCG          C
                     CAUA CUACG UG  GACCACAGCACUU   UCGGC          A
UCCGAGCGGACCUCUCCUAUC^   -     U  G-             UA-     CCAUUCUCCU 
       120       110        100         90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Dno-Mir-138-P2_5p

MirBase accessionMIMAT0047648
Sequence
0- AGCUGGUGUUGUGAAUCAGGCCG -23
Get sequence
Star sequence

Dno-Mir-138-P2_3p*

MirBase accessionMIMAT0047650
Sequence
47- GCUAUUUCACGACACCAGGGUU -69
Get sequence