MirGeneDB

MirGeneDB ID

Mmu-Mir-138-P2

Family name MIR-138 (all species)
Seed GCUGGUG
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-138-2
Paralogues Mmu-Mir-138-P1 
Orthologues Aca-Mir-138-P2  Ami-Mir-138-P2  Bta-Mir-138-P2  Cfa-Mir-138-P2  Cli-Mir-138-P2  Cpi-Mir-138-P2  Cpo-Mir-138-P2  Dno-Mir-138-P2  Dre-Mir-138-P2  Ete-Mir-138-P2  Gga-Mir-138-P2  Hsa-Mir-138-P2  Mdo-Mir-138-P2  Mml-Mir-138-P2  Oan-Mir-138-P2  Ocu-Mir-138-P2  Rno-Mir-138-P2  Sha-Mir-138-P2  Sto-Mir-138-P2  Tgu-Mir-138-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr8: 94324312-94324380 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGCCACCCAUUUCUGGUAUGGUUGCUGCAGCUGGUGUUGUGAAUCAGGCCGACGAGCAGCGCAUCCUCUUACCCGGCUAUUUCACGACACCAGGGUUGCACCCUACCCAUCCUCUCCAGGCAAGCGC
Get precursor sequence
Structure
        10            20        30        40        50        60    
GAAGCCACCCAUUUCUG----|  U   U  U  AG             UCA     ACGAGCAGCG 
                     GUA GGU GC GC  CUGGUGUUGUGAA   GGCCG          C
                     CAU CCA CG UG  GACCACAGCACUU   UCGGC          A
CGCGAACGGACCUCUCCUACC^  C   -  U  G-             UA-     CCAUUCUCCU 
       120       110        100         90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-138-P2_5p

MirBase accessionMIMAT0000150
Sequence
0- AGCUGGUGUUGUGAAUCAGGCCG -23
Get sequence
Validated targets microrna.org: MIMAT0000150
TargetScanVert: mmu-miR-138-5p
miRDB: MIMAT0000150
Star sequence

Mmu-Mir-138-P2_3p*

MirBase accessionMIMAT0016987
Sequence
47- GCUAUUUCACGACACCAGGGUU -69
Get sequence
Validated targets TargetScanVert: mmu-miR-138-2-3p
miRDB: MIMAT0016987