MirGeneDB

MirGeneDB ID

Aca-Mir-138-P2

Family name MIR-138 (all species)
Seed GCUGGUG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-138-1
Paralogues Aca-Mir-138-P1 
Orthologues Ami-Mir-138-P2  Bta-Mir-138-P2  Cfa-Mir-138-P2  Cli-Mir-138-P2  Cpi-Mir-138-P2  Cpo-Mir-138-P2  Dno-Mir-138-P2  Dre-Mir-138-P2  Ete-Mir-138-P2  Gga-Mir-138-P2  Hsa-Mir-138-P2  Mdo-Mir-138-P2  Mml-Mir-138-P2  Mmu-Mir-138-P2  Oan-Mir-138-P2  Ocu-Mir-138-P2  Rno-Mir-138-P2  Sha-Mir-138-P2  Sto-Mir-138-P2  Tgu-Mir-138-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343675.1: 287395-287462 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUGCGCCGAAGUCACGGUAUUGUUGCUGCAGCUGGUGUUGUGAAUCAGGCCGACAAAAAGCGCAUCUUACUAUCCGGCUAUUUCACUACACCAGGGUUGCAUCAUACCACUUGCCACCCGCUCGGAC
Get precursor sequence
Structure
        10           20        30        40        50        60    
CCUGCGCCGAAGUCACG---|   U U   U  AG       U     UCA     ACAAAAAGCG 
                    GUAU G UGC GC  CUGGUGU GUGAA   GGCCG          C
                    CAUA C ACG UG  GACCACA CACUU   UCGGC          A
CAGGCUCGCCCACCGUUCAC^   - U   U  G-       U     UA-     CUAUCAUUCU 
      120       110        100         90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-138-P2_5p

MirBase accessionMIMAT0021757
Sequence
0- AGCUGGUGUUGUGAAUCAGGCCG -23
Get sequence
Star sequence

Aca-Mir-138-P2_3p*

MirBase accessionMIMAT0021758
Sequence
47- GCUAUUUCACUACACCAGGGU -68
Get sequence