MirGeneDB

MirGeneDB ID

Sto-Mir-138-P2

Family name MIR-138 (all species)
Seed GCUGGUG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues Sto-Mir-138-P1 
Orthologues Aca-Mir-138-P2  Ami-Mir-138-P2  Bta-Mir-138-P2  Cfa-Mir-138-P2  Cli-Mir-138-P2  Cpi-Mir-138-P2  Cpo-Mir-138-P2  Dno-Mir-138-P2  Dre-Mir-138-P2  Ete-Mir-138-P2  Gga-Mir-138-P2  Hsa-Mir-138-P2  Mdo-Mir-138-P2  Mml-Mir-138-P2  Mmu-Mir-138-P2  Oan-Mir-138-P2  Ocu-Mir-138-P2  Rno-Mir-138-P2  Sha-Mir-138-P2  Tgu-Mir-138-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01002806.1: 176549-176616 [+]
Precursor
(pre-Mir +30nt flank)
UUAUAAUUCAGAACUUGGUAUGGGUGCAGCAGCUGGUGUUGUGAAUCAGGCCGGUAAAAAGCAACUGCUACGAUCCGGCUAUUUCACAACACCAGGGUUGCAUCAUACCACUAUCUUCAAUGCAAGAU
Get precursor sequence
Structure
        10           20        30        40        50        60    
UUAUAAUUCAGAACUUG---|     G      AG             UCA      UAAAAAGCA 
                    GUAUGG UGCAGC  CUGGUGUUGUGAA   GGCCGG         A
                    CAUACU ACGUUG  GACCACAACACUU   UCGGCC         C
UAGAACGUAACUUCUAUCAC^     -      G-             UA-      UAGCAUCGU 
      120       110        100         90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Sto-Mir-138-P2_5p

MirBase accessionNone
Sequence
0- AGCUGGUGUUGUGAAUCAGGCCGG -24
Get sequence
Star sequence

Sto-Mir-138-P2_3p*

MirBase accessionNone
Sequence
46- GGCUAUUUCACAACACCAGGGU -68
Get sequence