MirGeneDB

MirGeneDB ID

Hsa-Mir-138-P2

Family name MIR-138 (all species)
Seed GCUGGUG
Species Human (Homo sapiens)
MiRBase ID hsa-mir-138-2
Paralogues Hsa-Mir-138-P1 
Orthologues Aca-Mir-138-P2  Ami-Mir-138-P2  Bta-Mir-138-P2  Cfa-Mir-138-P2  Cli-Mir-138-P2  Cpi-Mir-138-P2  Cpo-Mir-138-P2  Dno-Mir-138-P2  Dre-Mir-138-P2  Ete-Mir-138-P2  Gga-Mir-138-P2  Mdo-Mir-138-P2  Mml-Mir-138-P2  Mmu-Mir-138-P2  Oan-Mir-138-P2  Ocu-Mir-138-P2  Rno-Mir-138-P2  Sha-Mir-138-P2  Sto-Mir-138-P2  Tgu-Mir-138-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr16: 56858527-56858595 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAGCCGGCGGAGUUCUGGUAUCGUUGCUGCAGCUGGUGUUGUGAAUCAGGCCGACGAGCAGCGCAUCCUCUUACCCGGCUAUUUCACGACACCAGGGUUGCAUCAUACCCAUCCUCUCCAGGCGAGCCU
Get precursor sequence
Structure
        10            20        30        40        50        60    
AAGCCGGCGGAGUUCUG----|   CGU   U  AG             UCA     ACGAGCAGCG 
                     GUAU   UGC GC  CUGGUGUUGUGAA   GGCCG          C
                     CAUA   ACG UG  GACCACAGCACUU   UCGGC          A
UCCGAGCGGACCUCUCCUACC^   CU-   U  G-             UA-     CCAUUCUCCU 
       120       110        100         90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-138-P2_5p

MirBase accessionMIMAT0000430
Sequence
0- AGCUGGUGUUGUGAAUCAGGCCG -23
Get sequence
Validated targets microrna.org: MIMAT0000430
TargetScanVert: hsa-miR-138-5p
TargetMiner: hsa-miR-138-5p
miRDB: MIMAT0000430
Star sequence

Hsa-Mir-138-P2_3p*

MirBase accessionMIMAT0004596
Sequence
47- GCUAUUUCACGACACCAGGGUU -69
Get sequence
Validated targets microrna.org: MIMAT0004596
TargetScanVert: hsa-miR-138-2-3p
TargetMiner: hsa-miR-138-2-3p
miRDB: MIMAT0004596