MirGeneDB

MirGeneDB ID

Mmu-Mir-138-P1

Family name MIR-138 (all species)
Seed GCUGGUG
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-138-1
Paralogues Mmu-Mir-138-P2 
Orthologues Aca-Mir-138-P1  Ami-Mir-138-P1  Bta-Mir-138-P1  Cfa-Mir-138-P1  Cli-Mir-138-P1  Cpo-Mir-138-P1  Dno-Mir-138-P1  Dre-Mir-138-P1  Ete-Mir-138-P1  Gga-Mir-138-P1  Hsa-Mir-138-P1  Mdo-Mir-138-P1  Mml-Mir-138-P1  Oan-Mir-138-P1  Ocu-Mir-138-P1  Rno-Mir-138-P1  Sha-Mir-138-P1  Sto-Mir-138-P1  Tgu-Mir-138-P1  Xtr-Mir-138-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr9: 122682898-122682958 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCAGAGACCUCUAGCAUGGUGUUGUGGGACAGCUGGUGUUGUGAAUCAGGCCGUUGCCAAUCAGAGAACGGCUACUUCACAACACCAGGGCCACACUGCACUGCAAGCAGCGAGCAGCAAG
Get precursor sequence
Structure
        10          20         30        40        50        60 
UCAGAGACCUCUAGCAU--     U   -| ACAG             UCA     UUGCCAA 
                   GGUGU GUG GG    CUGGUGUUGUGAA   GGCCG       \
                   UCACG CAC CC    GACCACAACACUU   UCGGC       U
GAACGACGAGCGACGAACG     U   A^ GG--             CA-     AAGAGAC 
 .       110       100        90          80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-138-P1_5p

MirBase accessionMIMAT0000150
Sequence
0- AGCUGGUGUUGUGAAUCAGGCCG -23
Get sequence
Validated targets microrna.org: MIMAT0000150
TargetScanVert: mmu-miR-138-5p
miRDB: MIMAT0000150
Star sequence

Mmu-Mir-138-P1_3p*

MirBase accessionMIMAT0004668
Sequence
40- GCUACUUCACAACACCAGGGC -61
Get sequence
Validated targets microrna.org: MIMAT0004668
TargetScanVert: mmu-miR-138-1-3p
miRDB: MIMAT0004668