MirGeneDB

MirGeneDB ID

Cli-Mir-138-P1

Family name MIR-138 (all species)
Seed GCUGGUG
Species Rock pigeon (Columba livia)
MiRBase ID cli-mir-138-1
Paralogues Cli-Mir-138-P2 
Orthologues Aca-Mir-138-P1  Ami-Mir-138-P1  Bta-Mir-138-P1  Cfa-Mir-138-P1  Cpo-Mir-138-P1  Dno-Mir-138-P1  Dre-Mir-138-P1  Ete-Mir-138-P1  Gga-Mir-138-P1  Hsa-Mir-138-P1  Mdo-Mir-138-P1  Mml-Mir-138-P1  Mmu-Mir-138-P1  Oan-Mir-138-P1  Ocu-Mir-138-P1  Rno-Mir-138-P1  Sha-Mir-138-P1  Sto-Mir-138-P1  Tgu-Mir-138-P1  Xtr-Mir-138-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(colLiv2)
scaffold380: 712512-712572 [+]
Precursor
(pre-Mir +30nt flank)
GCCAGGGGACCCCCUCAGGUGCCGUGCAGCAGCUGGUGUUGUGAAUCAGGCCGUCACCAGUCGGAGAACGGCUACUUCACAACACCAGGGUCGCACCGCACCACAGUUCGACCACCGGCCG
Get precursor sequence
Structure
        10          20        30        40        50        60 
GCCAGGGGACCCCCUCA--|    C    A  AG             UCA     UCACCAG 
                   GGUGC GUGC GC  CUGGUGUUGUGAA   GGCCG       \
                   CCACG CACG UG  GACCACAACACUU   UCGGC       U
GCCGGCCACCAGCUUGACA^    C    C  G-             CA-     AAGAGGC 
 .       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cli-Mir-138-P1_5p

MirBase accessionMIMAT0038522
Sequence
0- AGCUGGUGUUGUGAAUCAGGCCG -23
Get sequence
Star sequence

Cli-Mir-138-P1_3p*

MirBase accessionMIMAT0038523
Sequence
40- GCUACUUCACAACACCAGGGU -61
Get sequence