MirGeneDB

MirGeneDB ID

Bta-Mir-132-P2

Family name MIR-132 (all species)
Seed AACAGUC
Species Cow (Bos taurus)
MiRBase ID bta-mir-212
Paralogues Bta-Mir-132-P1 
Orthologues Aca-Mir-132-P2  Ami-Mir-132-P2  Cfa-Mir-132-P2  Cpi-Mir-132-P2  Cpo-Mir-132-P2  Dno-Mir-132-P2  Dre-Mir-132-P2a  Dre-Mir-132-P2b  Hsa-Mir-132-P2  Mdo-Mir-132-P2  Mml-Mir-132-P2  Mmu-Mir-132-P2  Oan-Mir-132-P2  Ocu-Mir-132-P2  Rno-Mir-132-P2  Sha-Mir-132-P2  Xtr-Mir-132-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr19: 23651588-23651649 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-132-P2)
Mir-132-P1 chr19: 23651161-23651218 [-] UCSC Ensembl
Mir-132-P2 chr19: 23651588-23651649 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGAGCCACCCUGCCCGGGCAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGGCCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCCUCAGGACCGCGG
Get precursor sequence
Structure
        10          20        30         40        50        60 
GGAGCCACCCUGCCCGGG--|  C   C   CA-  U     CU      C     GCCCGGG 
                    CAG GCG CGG   CC UGGCU  AGACUG UUACU       \
                    GUC CGC GCC   GG ACUGA  UCUGAC AAUGA       C
GGCGCCAGGACUCCGCCCCG^  -   A   ACC  C     CC      -     CUCCCGC 
120       110       100         90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-132-P2_5p*

MirBase accessionMIMAT0009264
Sequence
0- ACCUUGGCUCUAGACUGCUUACU -23
Get sequence
Validated targets TargetScanVert: bta-miR-212
Mature sequence

Bta-Mir-132-P2_3p

MirBase accessionNone
Sequence
40- UAACAGUCUCCAGUCACGGCCA -62
Get sequence