MirGeneDB

MirGeneDB ID

Aca-Mir-132-P2

Family name MIR-132 (all species)
Seed CCUUGGC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-212
Paralogues Aca-Mir-132-P1 
Orthologues Ami-Mir-132-P2  Bta-Mir-132-P2  Cfa-Mir-132-P2  Cpi-Mir-132-P2  Cpo-Mir-132-P2  Dno-Mir-132-P2  Dre-Mir-132-P2a  Dre-Mir-132-P2b  Hsa-Mir-132-P2  Mdo-Mir-132-P2  Mml-Mir-132-P2  Mmu-Mir-132-P2  Oan-Mir-132-P2  Ocu-Mir-132-P2  Rno-Mir-132-P2  Sha-Mir-132-P2  Xtr-Mir-132-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
G889P614625FH6: 277-344 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGGGUCCCUAUGGAAGGCCAGCGUGCCGGGACCUUGGCUCUAGACUGCUUACUGCGAAAUCCAAGGGGCGAAACAGUAACAGUCCACAGUCAUGGCUACUGACGGCUGGCGGUGGCAACCUUGUCCUC
Get precursor sequence
Structure
        10          20        30         40        50        60    
GGGGUCCCUAUGGAAGG--|    G  C   GA-  U     CUA     C     GCGAAAUCCA 
                   CCAGC UG CGG   CC UGGCU   GACUG UUACU          \
                   GGUCG GC GUC   GG ACUGA   CUGAC AAUGA          A
CUCCUGUUCCAACGGUGGC^    -  A   AUC  U     CAC     -     CAAAGCGGGG 
      120       110        100        90        80         70
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-132-P2_5p

MirBase accessionMIMAT0021869
Sequence
0- ACCUUGGCUCUAGACUGCUUACU -23
Get sequence
Co-mature sequence

Aca-Mir-132-P2_3p

MirBase accessionMIMAT0021870
Sequence
46- UAACAGUCCACAGUCAUGGCUA -68
Get sequence