MirGeneDB

MirGeneDB ID

Aca-Mir-132-P1

Family name MIR-132 (all species)
Seed CCGUGGC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-132
Paralogues Aca-Mir-132-P2 
Orthologues Ami-Mir-132-P1  Bta-Mir-132-P1  Cfa-Mir-132-P1  Cpi-Mir-132-P1  Cpo-Mir-132-P1  Dno-Mir-132-P1  Dre-Mir-132-P1a  Dre-Mir-132-P1b  Ete-Mir-132-P1  Hsa-Mir-132-P1  Mdo-Mir-132-P1  Mml-Mir-132-P1  Mmu-Mir-132-P1  Oan-Mir-132-P1  Ocu-Mir-132-P1  Rno-Mir-132-P1  Sha-Mir-132-P1  Sto-Mir-132-P1  Xtr-Mir-132-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
G889P62040RG10: 543-604 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AACGUCUCCACGGCAACCGUCUCCAGGGCAACCGUGGCUUUAGAUUGUUACUGUGCGGACGUGGGUUUGGUAACAGUCUACAGCCAUGGUUGGUCCGGCGGACGCAAAAGCGGCGGAAAGAA
Get precursor sequence
Structure
        10         20          30        40        50        60
AACGUCUCCACGGCAAC-     -| A    -          U            GUGCGGA 
                  CGUCU CC GGGC AACCGUGGCU UAGAUUGUUACU       C
                  GCAGG GG CCUG UUGGUACCGA AUCUGACAAUGG       G
AAGAAAGGCGGCGAAAAC     C^ -    G          C            UUUGGGU 
120       110       100         90        80        70
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-132-P1_5p

MirBase accessionMIMAT0021745
Sequence
0- ACCGUGGCUUUAGAUUGUUACU -22
Get sequence
Co-mature sequence

Aca-Mir-132-P1_3p

MirBase accessionMIMAT0021746
Sequence
40- UAACAGUCUACAGCCAUGGUUG -62
Get sequence