MirGeneDB

MirGeneDB ID

Aca-Mir-875

Family name MIR-875 (all species)
Seed AUACCUC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-875
Paralogues
Orthologues Ami-Mir-875  Bta-Mir-875  Cfa-Mir-875  Cli-Mir-875  Cpi-Mir-875  Ete-Mir-875  Hsa-Mir-875  Mdo-Mir-875  Mml-Mir-875  Mmu-Mir-875  Oan-Mir-875  Ocu-Mir-875  Rno-Mir-875  Sha-Mir-875 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343394.1: 622000-622056 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGCUUCAGGUUCUGUUUGUUUAGUGGUACAAUACCUCAGCCUUAUCAGGUGUUGUAUAUAUUCACCUGGAAGUACUGAGGUUGAGUUUCACUGAACAUAAGCUUCAUGUUUACUCU
Get precursor sequence
Structure
        10          20        30        40         50        
UUGCUUCAGGUUCUGUU--          U  AAU       C-|  A       UUGUA 
                   UGUUUAGUGG AC   ACCUCAG  CUU UCAGGUG     \
                   ACAAGUCACU UG   UGGAGUC  GAA GGUCCAC     U
UCUCAUUUGUACUUCGAAU          U  AGU       AU^  -       UUAUA 
     110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-875_5p

MirBase accessionMIMAT0021989
Sequence
0- AAUACCUCAGCCUUAUCAGGUG -22
Get sequence
Star sequence

Aca-Mir-875_3p* (predicted)

MirBase accessionNone
Sequence
35- CCUGGAAGUACUGAGGUUGAGU -57
Get sequence