MirGeneDB

MirGeneDB ID

Aca-Mir-26-P2

Family name MIR-26 (all species)
Seed UCAAGUA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID
Paralogues Aca-Mir-26-P1  Aca-Mir-26-P3 
Orthologues Ami-Mir-26-P2  Bta-Mir-26-P2  Cfa-Mir-26-P2  Cpi-Mir-26-P2  Cpo-Mir-26-P2  Dno-Mir-26-P2  Dre-Mir-26-P2  Ete-Mir-26-P2  Hsa-Mir-26-P2  Mdo-Mir-26-P2  Mml-Mir-26-P2  Mmu-Mir-26-P2  Oan-Mir-26-P2  Ocu-Mir-26-P2  Rno-Mir-26-P2  Sha-Mir-26-P2  Sto-Mir-26-P2  Xtr-Mir-26-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
2: 67040511-67040571 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGGCUAUUGCGUGAAGGCUUCAGCCUGGUUCAAGUAAUCCAGGAUAGGCUGUUACCAGGCAGUACGGCCUAUUCUUGAUUACUUGUUUCAGGAGGCGGCCCCUUGUCACAUUGAUACCA
Get precursor sequence
Structure
        10          20        30        40        50          
GAAGGCUAUUGCGUGAA--|   UCAG     UU         C          GUUACCA 
                   GGCU    CCUGG  CAAGUAAUC AGGAUAGGCU       \
                   CCGG    GGACU  GUUCAUUAG UCUUAUCCGG       G
ACCAUAGUUACACUGUUCC^   CGGA     UU         U          CAUGACG 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-26-P2_5p

MirBase accessionNone
Sequence
0- UUCAAGUAAUCCAGGAUAGGCU -22
Get sequence
Star sequence

Aca-Mir-26-P2_3p*

MirBase accessionNone
Sequence
39- CCUAUUCUUGAUUACUUGUUUC -61
Get sequence