MirGeneDB

MirGeneDB ID

Hsa-Mir-26-P2

Family name MIR-26 (all species)
Seed UCAAGUA
Species Human (Homo sapiens)
MiRBase ID hsa-mir-26a-2
Paralogues Hsa-Mir-26-P1  Hsa-Mir-26-P3 
Orthologues Aca-Mir-26-P2  Ami-Mir-26-P2  Bta-Mir-26-P2  Cfa-Mir-26-P2  Cpi-Mir-26-P2  Cpo-Mir-26-P2  Dno-Mir-26-P2  Dre-Mir-26-P2  Ete-Mir-26-P2  Mdo-Mir-26-P2  Mml-Mir-26-P2  Mmu-Mir-26-P2  Oan-Mir-26-P2  Ocu-Mir-26-P2  Rno-Mir-26-P2  Sha-Mir-26-P2  Sto-Mir-26-P2  Xtr-Mir-26-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr12: 57824620-57824679 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAGAAAGCUCCCAUAGAGGCUGUGGCUGGAUUCAAGUAAUCCAGGAUAGGCUGUUUCCAUCUGUGAGGCCUAUUCUUGAUUACUUGUUUCUGGAGGCAGCUGAUGGUCCGCCGCCGGAAA
Get precursor sequence
Structure
        10          20        30        40        50         
CAGAAAGCUCCCAUAGA--|     GG UG  UU         C          GUUUCC 
                   GGCUGU  C  GA  CAAGUAAUC AGGAUAGGCU      A
                   UCGACG  G  CU  GUUCAUUAG UCUUAUCCGG      U
AAAGGCCGCCGCCUGGUAG^     GA GU  UU         U          AGUGUC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-26-P2_5p

MirBase accessionMIMAT0000082
Sequence
0- UUCAAGUAAUCCAGGAUAGGCU -22
Get sequence
Validated targets microrna.org: MIMAT0000082
TargetScanVert: hsa-miR-26a-5p
TargetMiner: hsa-miR-26a-5p
miRDB: MIMAT0000082
Star sequence

Hsa-Mir-26-P2_3p*

MirBase accessionMIMAT0004681
Sequence
38- CCUAUUCUUGAUUACUUGUUUC -60
Get sequence
Validated targets microrna.org: MIMAT0004681
TargetScanVert: hsa-miR-26a-2-3p
TargetMiner: hsa-miR-26a-2-3p
miRDB: MIMAT0004681