MirGeneDB

MirGeneDB ID

Cpo-Mir-26-P2

Family name MIR-26 (all species)
Seed UCAAGUA
Species Guinea pig (Cavia porcellus)
MiRBase ID cpo-mir-26a-2
Paralogues Cpo-Mir-26-P1  Cpo-Mir-26-P3 
Orthologues Aca-Mir-26-P2  Ami-Mir-26-P2  Bta-Mir-26-P2  Cfa-Mir-26-P2  Cpi-Mir-26-P2  Dno-Mir-26-P2  Dre-Mir-26-P2  Ete-Mir-26-P2  Hsa-Mir-26-P2  Mdo-Mir-26-P2  Mml-Mir-26-P2  Mmu-Mir-26-P2  Oan-Mir-26-P2  Ocu-Mir-26-P2  Rno-Mir-26-P2  Sha-Mir-26-P2  Sto-Mir-26-P2  Xtr-Mir-26-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(cavPor3)
scaffold_9: 40004275-40004334 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CACAAUGCUCCCACAGAGGCUGUGGCUGGAUUCAAGUAAUCCAGGAUAGGCUGUUUCCAUCUGUGAGGCCUAUUCUUGAUUACUUGUUUCCGGAGGCAGCUGAUGGCCCACCGUCGGAAU
Get precursor sequence
Structure
        10          20        30        40        50         
CACAAUGCUCCCACAGA--|     GG     UU         C          GUUUCC 
                   GGCUGU  CUGGA  CAAGUAAUC AGGAUAGGCU      A
                   UCGACG  GGCCU  GUUCAUUAG UCUUAUCCGG      U
UAAGGCUGCCACCCGGUAG^     GA     UU         U          AGUGUC 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Mature sequence

Cpo-Mir-26-P2_5p

MirBase accessionMIMAT0046885
Sequence
0- UUCAAGUAAUCCAGGAUAGGCU -22
Get sequence
Star sequence

Cpo-Mir-26-P2_3p*

MirBase accessionMIMAT0046887
Sequence
38- CCUAUUCUUGAUUACUUGUUUC -60
Get sequence