MirGeneDB

MirGeneDB ID

Aca-Mir-26-P1

Family name MIR-26 (all species)
Seed UCAAGUA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-26-1
Paralogues Aca-Mir-26-P2  Aca-Mir-26-P3 
Orthologues Bta-Mir-26-P1  Cfa-Mir-26-P1  Cli-Mir-26-P1  Cpi-Mir-26-P1  Cpo-Mir-26-P1  Dno-Mir-26-P1  Dre-Mir-26-P1  Ete-Mir-26-P1  Gga-Mir-26-P1  Hsa-Mir-26-P1  Mdo-Mir-26-P1  Mml-Mir-26-P1  Mmu-Mir-26-P1  Oan-Mir-26-P1  Ocu-Mir-26-P1  Rno-Mir-26-P1  Sha-Mir-26-P1  Sto-Mir-26-P1  Xtr-Mir-26-P1a  Xtr-Mir-26-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
1: 88581323-88581383 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUGUCUUUAUGUAACAGGACUGUGGCCAGUUUCAAGUAAUCCAGGAUAGGCUGUGGGUACUGAUGUCAGCCUGUUCUUGAUUACUUGGCCUUGGAGGCAGCCGGUGGCAUCUUUUAGGACA
Get precursor sequence
Structure
        10          20        30        40        50          
UUGUCUUUAUGUAACAGGA--|   GG    UU          C          GUGGGUA 
                     CUGU  CCAG  UCAAGUAAUC AGGAUAGGCU       \
                     GACG  GGUU  GGUUCAUUAG UCUUGUCCGA       C
ACAGGAUUUUCUACGGUGGCC^   GA    CC          U          CUGUAGU 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-26-P1_5p

MirBase accessionMIMAT0021902
Sequence
0- UUCAAGUAAUCCAGGAUAGGCU -22
Get sequence
Star sequence

Aca-Mir-26-P1_3p*

MirBase accessionMIMAT0021903
Sequence
39- CCUGUUCUUGAUUACUUGGCCU -61
Get sequence