MirGeneDB

MirGeneDB ID

Sha-Mir-26-P1

Family name MIR-26 (all species)
Seed UCAAGUA
Species Tasmanian devil (Sarcophilus harrisii)
MiRBase ID
Paralogues Sha-Mir-26-P2  Sha-Mir-26-P3 
Orthologues Aca-Mir-26-P1  Bta-Mir-26-P1  Cfa-Mir-26-P1  Cli-Mir-26-P1  Cpi-Mir-26-P1  Cpo-Mir-26-P1  Dno-Mir-26-P1  Dre-Mir-26-P1  Ete-Mir-26-P1  Gga-Mir-26-P1  Hsa-Mir-26-P1  Mdo-Mir-26-P1  Mml-Mir-26-P1  Mmu-Mir-26-P1  Oan-Mir-26-P1  Ocu-Mir-26-P1  Rno-Mir-26-P1  Sto-Mir-26-P1  Xtr-Mir-26-P1a  Xtr-Mir-26-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(DEVIL7_traces)
GL849891.1: 2062376-2062432 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUCUCACCCCACUCGGUGGCCGGGACCCGUUUCAAGUAAUCCAGGAUAGGCUGUUUUCUCUUUAGCCUGUUCUCCAUUACUUGGUUCGGGGGCCGGUACUCAGCAUCACUUGGGGUG
Get precursor sequence
Structure
        10          20        30        40        50        
CUCUCACCCCACUCGGUG--|    GA    UU         CC          GUUUU 
                    GCCGG  CCCG  UCAAGUAAU  AGGAUAGGCU     \
                    UGGCC  GGGC  GGUUCAUUA  UCUUGUCCGA     C
GUGGGGUUCACUACGACUCA^    GG    UU         CC          UUUCU 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Bo Br He Ki Li Ly Pa Sk Sp Te
Mature sequence

Sha-Mir-26-P1_5p

MirBase accessionNone
Sequence
0- UUCAAGUAAUCCAGGAUAGGCU -22
Get sequence
Star sequence

Sha-Mir-26-P1_3p*

MirBase accessionNone
Sequence
35- CCUGUUCUCCAUUACUUGGUUC -57
Get sequence