MirGeneDB

MirGeneDB ID

Bta-Mir-26-P1

Family name MIR-26 (all species)
Seed UCAAGUA
Species Cow (Bos taurus)
MiRBase ID bta-mir-26b
Paralogues Bta-Mir-26-P2  Bta-Mir-26-P3 
Orthologues Aca-Mir-26-P1  Cfa-Mir-26-P1  Cli-Mir-26-P1  Cpi-Mir-26-P1  Cpo-Mir-26-P1  Dno-Mir-26-P1  Dre-Mir-26-P1  Ete-Mir-26-P1  Gga-Mir-26-P1  Hsa-Mir-26-P1  Mdo-Mir-26-P1  Mml-Mir-26-P1  Mmu-Mir-26-P1  Oan-Mir-26-P1  Ocu-Mir-26-P1  Rno-Mir-26-P1  Sha-Mir-26-P1  Sto-Mir-26-P1  Xtr-Mir-26-P1a  Xtr-Mir-26-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr2: 107133408-107133464 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCCUCGCCCCCACCCUGCCCGGGACCCAGUUCAAGUAAUUCAGGAUAGGUUGUGUGCUGUCCAGCCUGUUCUCCAUUACUUGGCUCGGGGGCCGGUGCCCUGCAGCCUUGGGGUGA
Get precursor sequence
Structure
        10          20         30        40        50        
CCCCUCGCCCCCACCCU-  -    GA   -|  U        UC          GUGUG 
                  GC CCGG  CCC AGU CAAGUAAU  AGGAUAGGUU     \
                  CG GGCC  GGG UCG GUUCAUUA  UCUUGUCCGA     C
AGUGGGGUUCCGACGUCC  U    GG   C^  -        CC          CCUGU 
     110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-26-P1_5p

MirBase accessionMIMAT0003531
Sequence
0- UUCAAGUAAUUCAGGAUAGGUU -22
Get sequence
Validated targets TargetScanVert: bta-miR-26b
Star sequence

Bta-Mir-26-P1_3p*

MirBase accessionNone
Sequence
35- CCUGUUCUCCAUUACUUGGCUC -57
Get sequence