MirGeneDB

MirGeneDB ID

Aca-Mir-196-P1

Family name MIR-196 (all species)
Seed AGGUAGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-196c
Paralogues Aca-Mir-196-P2  Aca-Mir-196-P3 
Orthologues Ami-Mir-196-P1  Bta-Mir-196-P1  Cfa-Mir-196-P1  Cin-Mir-196  Cli-Mir-196-P1  Cpi-Mir-196-P1  Cpo-Mir-196-P1  Dno-Mir-196-P1  Dre-Mir-196-P1  Gga-Mir-196-P1  Hsa-Mir-196-P1  Mdo-Mir-196-P1  Mml-Mir-196-P1  Mmu-Mir-196-P1  Ocu-Mir-196-P1  Rno-Mir-196-P1  Sha-Mir-196-P1  Sto-Mir-196-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Olfactores
Genome context
(anoCar2)
6: 75666553-75666613 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCAGAAAUGACCUAGAACUGUUCUGUGGAUUAGGUAGUUUCACGUUGUUGGGAAUUCAUUUUUAACACACAAGAACAUAAAACUACCUGAUUUACUCCAGUUUAUUCGCCUCGACGUUUUA
Get precursor sequence
Structure
        10            20        30        40        50          
CCAGAAAUGACCUAGAA----|  UUCU                CAC   G   GGAAUUCAU 
                     CUG    GUGGAUUAGGUAGUUU   GUU UUG         \
                     GAC    CAUUUAGUCCAUCAAA   CAA AAC         U
AUUUUGCAGCUCCGCUUAUUU^  CU--                AUA   G   ACACAAUUU 
 .       110       100          90        80        70
Deep sequencing
Go to detailed chart
CommentThe Dicer site is +1 relative to most other vertebrates examined.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-196-P1_5p

MirBase accessionMIMAT0021832
Sequence
0- UAGGUAGUUUCACGUUGUUGGGA -23
Get sequence
Star sequence

Aca-Mir-196-P1_3p*

MirBase accessionMIMAT0021833
Sequence
38- ACAAGAACAUAAAACUACCUGAU -61
Get sequence