MirGeneDB

MirGeneDB ID

Ocu-Mir-193-P1b

Family name MIR-193 (all species)
Seed ACUGGCC
Species Rabbit (Oryctolagus cuniculus)
MiRBase ID ocu-mir-193b
Paralogues Ocu-Mir-193-P1a  Ocu-Mir-193-P2a  Ocu-Mir-193-P2b 
Orthologues Aae-Mir-193-P1  Ami-Mir-193-P1b  Bge-Mir-193-P1  Bta-Mir-193-P1b  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1b  Cgi-Mir-193-P1  Cli-Mir-193-P1b  Cpi-Mir-193-P1b  Cpo-Mir-193-P1b  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1b  Dpu-Mir-193-P1  Dre-Mir-193-P1b  Ete-Mir-193-P1b  Gga-Mir-193-P1b  Hme-Mir-193-P1  Hsa-Mir-193-P1b  Isc-Mir-193-P1  Lgi-Mir-193-P1  Mdo-Mir-193-P1b  Mml-Mir-193-P1b  Mmu-Mir-193-P1b  Oan-Mir-193-P1b  Pmi-Mir-193-P1  Rno-Mir-193-P1b  Sha-Mir-193-P1b  Sto-Mir-193-P1b  Tca-Mir-193-P1  Tgu-Mir-193-P1b  Xtr-Mir-193-P1b 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(oryCun2)
chr6: 7412259-7412317 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-193-P1b)
Mir-193-P2b chr6: 7416450-7416510 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAAGGGGUUGGAGGCUGUGGGCCCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCACAAAGUCCCGCUUUUGGGGUCAUUCAGAACAGCGAGCGAUUC
Get precursor sequence
Structure
        10          20        30        40        50         
GCAAGGGGUUGGAGGCU--|   G       U    GU    A    G  A  AGUUUAU 
                   GUGG CCCAGAA CGGG  UUUG GGGC AG UG       \
                   UACU GGGUUUU GCCC  AAAC CCCG UC AC       G
CUUAGCGAGCGACAAGACU^   G       C    UG    A    G  A  CUAUUUU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
He Ki Te To Wh
Star sequence

Ocu-Mir-193-P1b_5p*

MirBase accessionMIMAT0048305
Sequence
0- CGGGGUUUUGAGGGCGAGAUGA -22
Get sequence
Mature sequence

Ocu-Mir-193-P1b_3p

MirBase accessionMIMAT0048306
Sequence
37- AACUGGCCCACAAAGUCCCGCU -59
Get sequence