MirGeneDB

MirGeneDB ID

Cpi-Mir-193-P1b

Family name MIR-193 (all species)
Seed ACUGGCC
Species Western painted turtle (Chrysemys picta bellii)
MiRBase ID cpi-mir-193b
Paralogues Cpi-Mir-193-P1a  Cpi-Mir-193-P2a  Cpi-Mir-193-P2b 
Orthologues Aae-Mir-193-P1  Ami-Mir-193-P1b  Bge-Mir-193-P1  Bta-Mir-193-P1b  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1b  Cgi-Mir-193-P1  Cli-Mir-193-P1b  Cpo-Mir-193-P1b  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1b  Dpu-Mir-193-P1  Dre-Mir-193-P1b  Ete-Mir-193-P1b  Gga-Mir-193-P1b  Hme-Mir-193-P1  Hsa-Mir-193-P1b  Isc-Mir-193-P1  Lgi-Mir-193-P1  Mdo-Mir-193-P1b  Mml-Mir-193-P1b  Mmu-Mir-193-P1b  Oan-Mir-193-P1b  Ocu-Mir-193-P1b  Pmi-Mir-193-P1  Rno-Mir-193-P1b  Sha-Mir-193-P1b  Sto-Mir-193-P1b  Tca-Mir-193-P1  Tgu-Mir-193-P1b  Xtr-Mir-193-P1b 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(chrPic1)
JH584814: 1978056-1978114 [-] UCSC
Precursor
(pre-Mir +30nt flank)
AUUGACUUCUGAAGAUUGUGGUUCCAGAGUCGGGGUUUUGGGGGCGAGAUGAGCUUAUGUUUUAUCCAACUGGCCCACAAAGUCCCGCUUUUGGUGGUCACUUUGUUCUGCAAAAGAAA
Get precursor sequence
Structure
        10         20         30        40        50         
AUUGACUUCUGAAGAUU-   GU -|     U    GU    G    G  A  AGCUUAU 
                  GUG  U CCAGAG CGGG  UUUG GGGC AG UG       \
                  CAC  G GGUUUU GCCC  AAAC CCCG UC AC       G
AAAGAAAACGUCUUGUUU   UG U^     C    UG    A    G  A  CUAUUUU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Te Te Te To
Star sequence

Cpi-Mir-193-P1b_5p*

MirBase accessionNone
Sequence
0- CGGGGUUUUGGGGGCGAGAUGA -22
Get sequence
Mature sequence

Cpi-Mir-193-P1b_3p

MirBase accessionMIMAT0037811
Sequence
37- AACUGGCCCACAAAGUCCCGCU -59
Get sequence