MirGeneDB

MirGeneDB ID

Bta-Mir-193-P1b

Family name MIR-193 (all species)
Seed GGGGUUU
Species Cow (Bos taurus)
MiRBase ID bta-mir-193b
Paralogues Bta-Mir-193-P1a  Bta-Mir-193-P2a  Bta-Mir-193-P2b 
Orthologues Aae-Mir-193-P1  Ami-Mir-193-P1b  Bge-Mir-193-P1  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1b  Cgi-Mir-193-P1  Cli-Mir-193-P1b  Cpi-Mir-193-P1b  Cpo-Mir-193-P1b  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1b  Dpu-Mir-193-P1  Dre-Mir-193-P1b  Ete-Mir-193-P1b  Gga-Mir-193-P1b  Hme-Mir-193-P1  Hsa-Mir-193-P1b  Isc-Mir-193-P1  Lgi-Mir-193-P1  Mdo-Mir-193-P1b  Mml-Mir-193-P1b  Mmu-Mir-193-P1b  Oan-Mir-193-P1b  Ocu-Mir-193-P1b  Pmi-Mir-193-P1  Rno-Mir-193-P1b  Sha-Mir-193-P1b  Sto-Mir-193-P1b  Tca-Mir-193-P1  Tgu-Mir-193-P1b  Xtr-Mir-193-P1b 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr25: 13339496-13339554 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-193-P1b)
Mir-193-P1b chr25: 13339496-13339554 [+] UCSC Ensembl
Mir-193-P2b chr25: 13344249-13344309 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGAGGCUUUGGAGGCUGUGGUCCCAGAAUCGGGGUUUUGAGGGCGAGAUGAGUUUAUGUUUUAUCCAACUGGCCCACAAAGUCCCGCUUUUGGGGUCAUUCUAGACGGCGAGGGAUUC
Get precursor sequence
Structure
        10          20        30        40        50         
AGGAGGCUUUGGAGGCU--|  GU       U    GU    A    G  A  AGUUUAU 
                   GUG  CCCAGAA CGGG  UUUG GGGC AG UG       \
                   UAC  GGGUUUU GCCC  AAAC CCCG UC AC       G
CUUAGGGAGCGGCAGAUCU^  UG       C    UG    A    G  A  CUAUUUU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-193-P1b_5p

MirBase accessionNone
Sequence
0- CGGGGUUUUGAGGGCGAGAUGA -22
Get sequence
Co-mature sequence

Bta-Mir-193-P1b_3p

MirBase accessionMIMAT0009253
Sequence
37- AACUGGCCCACAAAGUCCCGCU -59
Get sequence
Validated targets TargetScanVert: bta-miR-193b