MirGeneDB

MirGeneDB ID

Ete-Mir-193-P1b

Family name MIR-193 (all species)
Seed ACUGGCC
Species Lesser hedgehog tenrec (Echinops telfairi)
MiRBase ID
Paralogues Ete-Mir-193-P1a  Ete-Mir-193-P2a  Ete-Mir-193-P2b 
Orthologues Aae-Mir-193-P1  Ami-Mir-193-P1b  Bge-Mir-193-P1  Bta-Mir-193-P1b  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1b  Cgi-Mir-193-P1  Cli-Mir-193-P1b  Cpi-Mir-193-P1b  Cpo-Mir-193-P1b  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1b  Dpu-Mir-193-P1  Dre-Mir-193-P1b  Gga-Mir-193-P1b  Hme-Mir-193-P1  Hsa-Mir-193-P1b  Isc-Mir-193-P1  Lgi-Mir-193-P1  Mdo-Mir-193-P1b  Mml-Mir-193-P1b  Mmu-Mir-193-P1b  Oan-Mir-193-P1b  Ocu-Mir-193-P1b  Pmi-Mir-193-P1  Rno-Mir-193-P1b  Sha-Mir-193-P1b  Sto-Mir-193-P1b  Tca-Mir-193-P1  Tgu-Mir-193-P1b  Xtr-Mir-193-P1b 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(echTel2)
JH980314: 43338902-43338960 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CUUAGGCUUUGCAGGCUGUGGCCCCAGAGGCGGGGUUUUGAGGGCAAGAUGAGUUUUCGUGUUACCCAACUGGCCCACAAAGUCCCGCUUUUGGGGUCAUGCGAACCAUCGAGGAAUUC
Get precursor sequence
Structure
        10          20        30        40        50         
CUUAGGCUUUGCAGGCU--|                GU    A    A  A  AGUUUUC 
                   GUGGCCCCAGAGGCGGG  UUUG GGGC AG UG       \
                   UACUGGGGUUUUCGCCC  AAAC CCCG UC AC       G
CUUAAGGAGCUACCAAGCG^                UG    A    G  A  CCAUUGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Ete-Mir-193-P1b_5p*

MirBase accessionNone
Sequence
0- CGGGGUUUUGAGGGCAAGAUGA -22
Get sequence
Mature sequence

Ete-Mir-193-P1b_3p

MirBase accessionNone
Sequence
37- AACUGGCCCACAAAGUCCCGCU -59
Get sequence