MirGeneDB

MirGeneDB ID

Xtr-Mir-456

Family name MIR-456 (all species)
Seed AGGCUGG
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID
Paralogues
Orthologues Aca-Mir-456  Ami-Mir-456  Cli-Mir-456  Cpi-Mir-456  Dre-Mir-456  Gga-Mir-456  Sto-Mir-456  Tgu-Mir-456 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021654: 83538139-83538199 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GGCUGCCACUUAAGCUUUGUGUGUGUGUGAGCAGGCAUCUUCUCAGCCUACAUGUAGAUUGUCAAAUCUGCAGGCUGGUUAGAUGGUUGUCAUACAUUCAUUUGAUAUCUGCAAAAAAGCU
Get precursor sequence
Structure
        10          20        30        40        50        60
GGCUGCCACUUAAGCUUU--|  U        G   G     UC       A  UGUAGAU 
                    GUG GUGUGUGA CAG CAUCU  UCAGCCU CA       U
                    UAC UACAUACU GUU GUAGA  GGUCGGA GU       G
UCGAAAAAACGUCUAUAGUU^  U        -   G     UU       C  CUAAACU 
 .       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Br Em Em Em Em He
Star sequence

Xtr-Mir-456_5p* (predicted)

MirBase accessionNone
Sequence
0- GCAGGCAUCUUCUCAGCCUACA -22
Get sequence
Mature sequence

Xtr-Mir-456_3p

MirBase accessionNone
Sequence
40- CAGGCUGGUUAGAUGGUUGUC -61
Get sequence