MirGeneDB

MirGeneDB ID

Tgu-Mir-456

Family name MIR-456 (all species)
Seed AGGCUGG
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-456
Paralogues
Orthologues Aca-Mir-456  Ami-Mir-456  Cli-Mir-456  Cpi-Mir-456  Dre-Mir-456  Gga-Mir-456  Sto-Mir-456  Xtr-Mir-456 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
3: 36454445-36454505 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGCUCNNNNNNNNNNNNNNNNNNNNNNNNAGCAGGCAUCUUCUCAGCCUACAUGUGGAUUCCUAAAUCUGCAGGCUGGUUAGAUGGUUGUCAUGCAUUCAUCUGAUAUCUACUGAAAUUCA
Get precursor sequence
Structure
        10        20        30         40        50        60
UGCUCNNNNNNNNNNNNNNNNNNNNNNNNA-|   G     UC       A  UGUGGAU 
                               GCAG CAUCU  UCAGCCU CA       U
                               UGUU GUAGA  GGUCGGA GU       C
ACUUAAAGUCAUCUAUAGUCUACUUACGUAC^   G     UU       C  CUAAAUC 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Star sequence

Tgu-Mir-456_5p*

MirBase accessionMIMAT0026964
Sequence
0- GCAGGCAUCUUCUCAGCCUACA -22
Get sequence
Mature sequence

Tgu-Mir-456_3p

MirBase accessionMIMAT0014469
Sequence
40- CAGGCUGGUUAGAUGGUUGUC -61
Get sequence