MirGeneDB

MirGeneDB ID

Aca-Mir-456

Family name MIR-456 (all species)
Seed AGGCUGG
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-456
Paralogues
Orthologues Ami-Mir-456  Cli-Mir-456  Cpi-Mir-456  Dre-Mir-456  Gga-Mir-456  Sto-Mir-456  Tgu-Mir-456  Xtr-Mir-456 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
1: 231781997-231782057 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CAUCCUAUACAGUGUUAUGUGUAUGUGUGAGCAGGCAUCUUCUCAGCCUACAUGUGGAUUCCUAAAUCUGCAGGCUGGUUAGAUGGUUGUCAUACAUUCAUCUAAUGUCUGCUUAACAGAA
Get precursor sequence
Structure
        10          20        30        40        50        60
CAUCCUAUACAGUGUUAU--|  U        G   G     UC       A  UGUGGAU 
                    GUG AUGUGUGA CAG CAUCU  UCAGCCU CA       U
                    UAC UACAUACU GUU GUAGA  GGUCGGA GU       C
AAGACAAUUCGUCUGUAAUC^  U        -   G     UU       C  CUAAAUC 
 .       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-456_5p*

MirBase accessionNone
Sequence
0- GCAGGCAUCUUCUCAGCCUACA -22
Get sequence
Mature sequence

Aca-Mir-456_3p

MirBase accessionMIMAT0021966
Sequence
40- CAGGCUGGUUAGAUGGUUGUC -61
Get sequence