MirGeneDB

MirGeneDB ID

Gga-Mir-456

Family name MIR-456 (all species)
Seed AGGCUGG
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-456
Paralogues
Orthologues Aca-Mir-456  Ami-Mir-456  Cli-Mir-456  Cpi-Mir-456  Dre-Mir-456  Sto-Mir-456  Tgu-Mir-456  Xtr-Mir-456 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(galGal5)
3: 31514597-31514657 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUUUAAGCUGCUGUGUGUGUGCGUGUGUGAGCAGGCAUCUUCUCAGCCUACAUGUGGAUUCCUAAAUCUGCAGGCUGGUUAGAUGGUUGUCAUGCAUUCAUCUGAUAACUGCUGAAUUUUA
Get precursor sequence
Structure
        10          20        30        40        50        60
AUUUAAGCUGCUGUGUGU--|  C        G   G     UC       A  UGUGGAU 
                    GUG GUGUGUGA CAG CAUCU  UCAGCCU CA       U
                    UAC UACGUACU GUU GUAGA  GGUCGGA GU       C
AUUUUAAGUCGUCAAUAGUC^  U        -   G     UU       C  CUAAAUC 
 .       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Star sequence

Gga-Mir-456_5p*

MirBase accessionMIMAT0026645
Sequence
0- GCAGGCAUCUUCUCAGCCUACA -22
Get sequence
Validated targets TargetScanVert: gga-miR-456-5p
miRDB: MIMAT0026645
Mature sequence

Gga-Mir-456_3p

MirBase accessionMIMAT0003777
Sequence
40- CAGGCUGGUUAGAUGGUUGUC -61
Get sequence
Validated targets TargetScanVert: gga-miR-456-3p
miRDB: MIMAT0003777