MirGeneDB

MirGeneDB ID

Sto-Mir-456

Family name MIR-456 (all species)
Seed AGGCUGG
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues Aca-Mir-456  Ami-Mir-456  Cli-Mir-456  Cpi-Mir-456  Dre-Mir-456  Gga-Mir-456  Tgu-Mir-456  Xtr-Mir-456 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01004133.1: 183395-183455 [-]
Precursor
(pre-Mir +30nt flank)
UAGUGCAUUGUGAAGCUGUUGUGUGCGUGAGCAGGCAUCUAUCCAGCCUACACGUAGGUGAUGAAAUCUGCAGGCUGGUUAGAUGGUUGUCCUGCACACAGCACGGGCCCACAUUGCUGUC
Get precursor sequence
Structure
        10          20        30        40        50        60
UAGUGCAUUGUGAAGCU--|         U  G   G      U       A  CGUAGGU 
                   GUUGUGUGCG GA CAG CAUCUA CCAGCCU CA       G
                   CGACACACGU CU GUU GUAGAU GGUCGGA GU       A
CUGUCGUUACACCCGGGCA^         C  -   G      U       C  CUAAAGU 
 .       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Sto-Mir-456_5p*

MirBase accessionNone
Sequence
0- GCAGGCAUCUAUCCAGCCUACA -22
Get sequence
Mature sequence

Sto-Mir-456_3p

MirBase accessionNone
Sequence
40- CAGGCUGGUUAGAUGGUUGUC -61
Get sequence