MirGeneDB

MirGeneDB ID

Xtr-Mir-122

Family name MIR-122 (all species)
Seed GGAGUGU
Species Tropical clawed frog (Xenopus tropicalis)
MiRBase ID xtr-mir-122
Paralogues
Orthologues Aca-Mir-122  Ami-Mir-122  Bta-Mir-122  Cfa-Mir-122  Cli-Mir-122  Cpi-Mir-122  Cpo-Mir-122  Dno-Mir-122  Dre-Mir-122  Ete-Mir-122  Gga-Mir-122-P1  Gga-Mir-122-P2  Hsa-Mir-122  Hsa-Mir-122-as  Mdo-Mir-122  Mml-Mir-122  Mmu-Mir-122  Oan-Mir-122  Ocu-Mir-122  Rno-Mir-122  Sha-Mir-122  Sto-Mir-122  Tgu-Mir-122 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(xenTro7)
KB021649: 18336873-18336930 [+] UCSC
Precursor
(pre-Mir +30nt flank)
UUCUGAUCGGGAGUCGGACUGCUGGAGCUAUGGAGUGUGACAAUGGUGUUUGUGUCAGAGCUAUCAAACGCCAUUAUCACACUAAUGAGCUACUGCAGGCACACUCACUCACUGGCUG
Get precursor sequence
Structure
        10          20        30        40        50        
UUCUGAUCGGGAGUCGGA--|   UGG    AUGG       C           UGUCA 
                    CUGC   AGCU    AGUGUGA AAUGGUGUUUG     G
                    GACG   UCGA    UCACACU UUACCGCAAAC     A
GUCGGUCACUCACUCACACG^   UCA    GUAA       A           UAUCG 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Br Em Em Em Em He
Mature sequence

Xtr-Mir-122_5p

MirBase accessionMIMAT0003585
Sequence
0- UGGAGUGUGACAAUGGUGUUUG -22
Get sequence
Validated targets TargetScanVert: xtr-miR-122
Star sequence

Xtr-Mir-122_3p*

MirBase accessionNone
Sequence
36- AACGCCAUUAUCACACUAAUGA -58
Get sequence