MirGeneDB

MirGeneDB ID

Aca-Mir-122

Family name MIR-122 (all species)
Seed GGAGUGU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-122
Paralogues
Orthologues Ami-Mir-122  Bta-Mir-122  Cfa-Mir-122  Cli-Mir-122  Cpi-Mir-122  Cpo-Mir-122  Dno-Mir-122  Dre-Mir-122  Ete-Mir-122  Gga-Mir-122-P1  Gga-Mir-122-P2  Hsa-Mir-122  Hsa-Mir-122-as  Mdo-Mir-122  Mml-Mir-122  Mmu-Mir-122  Oan-Mir-122  Ocu-Mir-122  Rno-Mir-122  Sha-Mir-122  Sto-Mir-122  Tgu-Mir-122  Xtr-Mir-122 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
GL343213.1: 2690958-2691015 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUUAAGGAUCUUCUUUCCUGCUGGAGCUGUGGAGUGUGACAAUGGUGUUUGUAUCCAAUCCGUCAAACGCCAUUAUCACACUAAAUAGCUACUGCUAGAGAAGCCAUCGGUUCAGGU
Get precursor sequence
Structure
        10         20         30        40        50        
CCUUAAGGAUCUUCUUUC-  -| UGG      GG       C           UAUCC 
                   CU GC   AGCUGU  AGUGUGA AAUGGUGUUUG     A
                   GA CG   UCGAUA  UCACACU UUACCGCAAAC     A
UGGACUUGGCUACCGAAGA  U^ UCA      AA       A           UGCCU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-122_5p

MirBase accessionMIMAT0021723
Sequence
0- UGGAGUGUGACAAUGGUGUUUG -22
Get sequence
Star sequence

Aca-Mir-122_3p*

MirBase accessionMIMAT0021724
Sequence
36- AACGCCAUUAUCACACUAAAUA -58
Get sequence