MirGeneDB

MirGeneDB ID

Gga-Mir-122-P1

Family name MIR-122 (all species)
Seed GGAGUGU
Species Chicken (Gallus gallus)
MiRBase ID gga-mir-122-1
Paralogues Gga-Mir-122-P2 
Orthologues Aca-Mir-122  Ami-Mir-122  Bta-Mir-122  Cfa-Mir-122  Cli-Mir-122  Cpi-Mir-122  Cpo-Mir-122  Dno-Mir-122  Dre-Mir-122  Ete-Mir-122  Hsa-Mir-122  Mdo-Mir-122  Mml-Mir-122  Mmu-Mir-122  Oan-Mir-122  Ocu-Mir-122  Rno-Mir-122  Sha-Mir-122  Sto-Mir-122  Tgu-Mir-122  Xtr-Mir-122 
Node of Origin (locus) G. gallus
Node of Origin (family) Vertebrata
Genome context
(galGal5)
Z: 761129-761186 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCAUGGGCUAACAAUCUGCUGCCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCCAAUCUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGGUAGAUGAGACUUCAAGUCAGAG
Get precursor sequence
Structure
        10         20         30        40        50        
CCAUGGGCUAACAAUCUG-       -|     GG       C           UGUCC 
                   CUGCCAG AGCUGU  AGUGUGA AAUGGUGUUUG     A
                   GAUGGUC UCGAUA  UCACACU UUACCGCAAAC     A
GAGACUGAACUUCAGAGUA       A^     AA       A           UAUCU 
      110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Ad Ad Br Br Ce Ce Ce Ce Ch He He Hy Hy Ki Ki Li Li Lu Lu Ov Pr Pr Sc Sc Sp Sp Te
Mature sequence

Gga-Mir-122-P1_5p

MirBase accessionMIMAT0001190
Sequence
0- UGGAGUGUGACAAUGGUGUUUG -22
Get sequence
Validated targets TargetScanVert: gga-miR-122-5p
miRDB: MIMAT0001190
Star sequence

Gga-Mir-122-P1_3p*

MirBase accessionMIMAT0026550
Sequence
36- AACGCCAUUAUCACACUAAAUA -58
Get sequence
Validated targets TargetScanVert: gga-miR-122-3p
miRDB: MIMAT0026550