MirGeneDB

MirGeneDB ID

Sto-Mir-122

Family name MIR-122 (all species)
Seed GGAGUGU
Species Cloudy Catshark (Scyliorhinus torazame)
MiRBase ID
Paralogues
Orthologues Aca-Mir-122  Ami-Mir-122  Bta-Mir-122  Cfa-Mir-122  Cli-Mir-122  Cpi-Mir-122  Cpo-Mir-122  Dno-Mir-122  Dre-Mir-122  Ete-Mir-122  Gga-Mir-122-P1  Gga-Mir-122-P2  Hsa-Mir-122  Hsa-Mir-122-as  Mdo-Mir-122  Mml-Mir-122  Mmu-Mir-122  Oan-Mir-122  Ocu-Mir-122  Rno-Mir-122  Sha-Mir-122  Tgu-Mir-122  Xtr-Mir-122 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(miRNA_loci_genome)
BFAA01002600.1: 28843-28901 [-]
Precursor
(pre-Mir +30nt flank)
GCGCCGUCGCUUCUGUUCUGCUGGUAGCUGUGGAGUGUGACAAUGGUGUUUGUGUGGAGUUAAAUCAAACGCCAUUAUCACACUAAAUAGCUCGGGUGGGAACCAGCCACACAUACACA
Get precursor sequence
Structure
        10           20        30        40        50         
GCGCCGUCGCUUCUGUU---|UG  GGU      GG       C           UGUGGA 
                    C  CU   AGCUGU  AGUGUGA AAUGGUGUUUG      \
                    G  GG   UCGAUA  UCACACU UUACCGCAAAC      G
ACACAUACACACCGACCAAG^GU  GC-      AA       A           UAAAUU 
       110       100         90        80        70        60
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site +1 on the 3p arm relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Sto-Mir-122_5p

MirBase accessionNone
Sequence
0- UGGAGUGUGACAAUGGUGUUUGU -23
Get sequence
Star sequence

Sto-Mir-122_3p*

MirBase accessionNone
Sequence
37- AACGCCAUUAUCACACUAAAUA -59
Get sequence