MirGeneDB

MirGeneDB ID

Tgu-Mir-21

Family name MIR-21 (all species)
Seed AGCUUAU
Species Zebra finch (Taeniopygia guttata)
MiRBase ID tgu-mir-21
Paralogues
Orthologues Aca-Mir-21  Ami-Mir-21  Bta-Mir-21  Cfa-Mir-21  Cli-Mir-21  Cpi-Mir-21  Cpo-Mir-21  Dno-Mir-21  Dre-Mir-21-P1  Dre-Mir-21-P2  Ete-Mir-21  Gga-Mir-21  Hsa-Mir-21  Mdo-Mir-21  Mml-Mir-21  Mmu-Mir-21  Oan-Mir-21  Ocu-Mir-21  Rno-Mir-21  Sha-Mir-21  Sto-Mir-21  Xtr-Mir-21 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(taeGut3.2.4)
19: 8993805-8993865 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCAUGCCAUGGCUGUACCAUCCUGUCGGAUAGCUUAUCAGACUGAUGUUGACUGUUGGAUCUCAUGGCAACAACAGUCGGUAGGCUGUCUGACAUUUUGGUAUCUCUCAUCUGACCCUUC
Get precursor sequence
Structure
        10           20        30        40        50        60
GCCAUGCCAUGGCUGUA---|  UCC                A     A     A UGUUGG 
                    CCA   UGUCGGAUAGCUUAUC GACUG UGUUG C      A
                    GGU   ACAGUCUGUCGGAUGG CUGAC ACAAC G      U
CUUCCCAGUCUACUCUCUAU^  UUU                -     A     - GUACUC 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Fe Fe Fe Fe Ma Ma Ma Ma
Mature sequence

Tgu-Mir-21_5p

MirBase accessionMIMAT0014527
Sequence
0- UAGCUUAUCAGACUGAUGUUGAC -23
Get sequence
Star sequence

Tgu-Mir-21_3p*

MirBase accessionMIMAT0014636
Sequence
38- CAACAACAGUCGGUAGGCUGUCU -61
Get sequence