MirGeneDB

MirGeneDB ID

Mmu-Mir-21

Family name MIR-21 (all species)
Seed AGCUUAU
Species House mouse (Mus musculus)
MiRBase ID mmu-mir-21a
Paralogues
Orthologues Aca-Mir-21  Ami-Mir-21  Bta-Mir-21  Cfa-Mir-21  Cli-Mir-21  Cpi-Mir-21  Cpo-Mir-21  Dno-Mir-21  Dre-Mir-21-P1  Dre-Mir-21-P2  Ete-Mir-21  Gga-Mir-21  Hsa-Mir-21  Mdo-Mir-21  Mml-Mir-21  Oan-Mir-21  Ocu-Mir-21  Rno-Mir-21  Sha-Mir-21  Sto-Mir-21  Tgu-Mir-21  Xtr-Mir-21 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(mm10)
chr11: 86584082-86584141 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GACAUCGCAUGGCUGUACCACCUUGUCGGAUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACAGCAGUCGAUGGGCUGUCUGACAUUUUGGUAUCUUUCAUCUGACCAUC
Get precursor sequence
Structure
        10          20        30        40        50        60
GACAUCGCAUGGCUGUA--|  CCU                A     A     A  GUUGA 
                   CCA   UGUCGGAUAGCUUAUC GACUG UGUUG CU     A
                   GGU   ACAGUCUGUCGGGUAG CUGAC ACAAC GG     U
CUACCAGUCUACUUUCUAU^  UUU                -     G     -  UACUC 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Br Br Ce Ce Es He Ki Li Lu Ov Pa Sk Sp Te Em
Mature sequence

Mmu-Mir-21_5p

MirBase accessionMIMAT0000530
Sequence
0- UAGCUUAUCAGACUGAUGUUGACU -24
Get sequence
Validated targets microrna.org: MIMAT0000530
TargetScanVert: mmu-miR-21a-5p
miRDB: MIMAT0000530
Star sequence

Mmu-Mir-21_3p*

MirBase accessionMIMAT0004628
Sequence
38- CAACAGCAGUCGAUGGGCUGUC -60
Get sequence
Validated targets microrna.org: MIMAT0004628
TargetScanVert: mmu-miR-21a-3p
miRDB: MIMAT0004628