MirGeneDB

MirGeneDB ID

Hsa-Mir-21

Family name MIR-21 (all species)
Seed AGCUUAU
Species Human (Homo sapiens)
MiRBase ID hsa-mir-21
Paralogues
Orthologues Aca-Mir-21  Ami-Mir-21  Bta-Mir-21  Cfa-Mir-21  Cli-Mir-21  Cpi-Mir-21  Cpo-Mir-21  Dno-Mir-21  Dre-Mir-21-P1  Dre-Mir-21-P2  Ete-Mir-21  Gga-Mir-21  Mdo-Mir-21  Mml-Mir-21  Mmu-Mir-21  Oan-Mir-21  Ocu-Mir-21  Rno-Mir-21  Sha-Mir-21  Sto-Mir-21  Tgu-Mir-21  Xtr-Mir-21 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(hg38)
chr17: 59841273-59841332 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAUCUCCAUGGCUGUACCACCUUGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACAUUUUGGUAUCUUUCAUCUGACCAUC
Get precursor sequence
Structure
        10          20        30        40        50        60
ACAUCUCCAUGGCUGUA--|  CCU      GU        A     A     A  GUUGA 
                   CCA   UGUCGG  AGCUUAUC GACUG UGUUG CU     A
                   GGU   ACAGUC  UCGGGUAG CUGAC ACAAC GG     U
CUACCAGUCUACUUUCUAU^  UUU      UG        -     C     -  UACUC 
.       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Bo Bo Bo Bo Br Br Ce Co Fo He Ki Li Li Lu Pa Pl Sk Sk Sk Sm Sp Sp St Te Th Ut
Mature sequence

Hsa-Mir-21_5p

MirBase accessionMIMAT0000076
Sequence
0- UAGCUUAUCAGACUGAUGUUGACU -24
Get sequence
Validated targets microrna.org: MIMAT0000076
TargetScanVert: hsa-miR-21-5p
TargetMiner: hsa-miR-21-5p
miRDB: MIMAT0000076
Star sequence

Hsa-Mir-21_3p*

MirBase accessionMIMAT0004494
Sequence
38- CAACACCAGUCGAUGGGCUGUC -60
Get sequence
Validated targets microrna.org: MIMAT0004494
TargetScanVert: hsa-miR-21-3p
TargetMiner: hsa-miR-21-3p
miRDB: MIMAT0004494