MirGeneDB

MirGeneDB ID

Bta-Mir-193-P1a

Family name MIR-193 (all species)
Seed GGGUCUU
Species Cow (Bos taurus)
MiRBase ID bta-mir-193a
Paralogues Bta-Mir-193-P1b  Bta-Mir-193-P2a  Bta-Mir-193-P2b 
Orthologues Aae-Mir-193-P1  Aca-Mir-193-P1a  Ami-Mir-193-P1a  Bge-Mir-193-P1  Cbr-Mir-193-P1-v1  Cbr-Mir-193-P1-v2  Cel-Mir-193-P1-v1  Cel-Mir-193-P1-v2  Cfa-Mir-193-P1a  Cgi-Mir-193-P1  Cpi-Mir-193-P1a  Cpo-Mir-193-P1a  Cte-Mir-193-P1  Dan-Mir-193-P1-v1  Dan-Mir-193-P1-v2  Dan-Mir-193-P1-v3  Dan-Mir-193-P1-v4  Dme-Mir-193-P1-v1  Dme-Mir-193-P1-v2  Dme-Mir-193-P1-v3  Dme-Mir-193-P1-v4  Dmo-Mir-193-P1-v1  Dmo-Mir-193-P1-v2  Dmo-Mir-193-P1-v3  Dmo-Mir-193-P1-v4  Dno-Mir-193-P1a  Dpu-Mir-193-P1  Dre-Mir-193-P1a1  Dre-Mir-193-P1a2  Ete-Mir-193-P1a  Gga-Mir-193-P1a  Hme-Mir-193-P1  Hsa-Mir-193-P1a  Isc-Mir-193-P1  Lgi-Mir-193-P1  Mdo-Mir-193-P1a  Mml-Mir-193-P1a  Mmu-Mir-193-P1a  Oan-Mir-193-P1a  Ocu-Mir-193-P1a  Pmi-Mir-193-P1  Rno-Mir-193-P1a  Sha-Mir-193-P1a  Tca-Mir-193-P1  Tgu-Mir-193-P1a 
Node of Origin (locus) Gnathostomata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr19: 18824232-18824287 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUAAUCCGAGACGCGUGGGAGCUGAGAGCUGGGUCUUUGCGGGCGAGAUGAAGGUGUCGGUUCAACUGGCCUACAAAGUCCCAGUCCUCGGCCCCCAGGACCGACGGCUCCUCCU
Get precursor sequence
Structure
        10          20        30        40        50       
CCUAAUCCGAGACGCGU--|  A      AG     U     CG   G  A   AGGU 
                   GGG GCUGAG  CUGGG CUUUG  GGC AG UGA    G
                   CCC CGGCUC  GACCC GAAAC  CCG UC ACU    U
UCCUCCUCGGCAGCCAGGA^  C      CU     U     AU   G  A   UGGC 
    110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-193-P1a_5p

MirBase accessionMIMAT0003794
Sequence
0- UGGGUCUUUGCGGGCGAGAUGA -22
Get sequence
Validated targets TargetScanVert: bta-miR-193a-5p
Co-mature sequence

Bta-Mir-193-P1a_3p

MirBase accessionMIMAT0003795
Sequence
34- AACUGGCCUACAAAGUCCCAGU -56
Get sequence
Validated targets TargetScanVert: bta-miR-193a-3p